Incidental Mutation 'R8023:Grhl3'
ID617520
Institutional Source Beutler Lab
Gene Symbol Grhl3
Ensembl Gene ENSMUSG00000037188
Gene Namegrainyhead like transcription factor 3
SynonymsSom, ct, Get1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R8023 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location135541888-135573630 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135550329 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 475 (V475A)
Ref Sequence ENSEMBL: ENSMUSP00000101481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105855]
Predicted Effect probably benign
Transcript: ENSMUST00000105855
AA Change: V475A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101481
Gene: ENSMUSG00000037188
AA Change: V475A

DomainStartEndE-ValueType
Pfam:CP2 215 421 2.5e-81 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the grainyhead family of transcription factors. The encoded protein may function as a transcription factor during development, and has been shown to stimulate migration of endothelial cells. Multiple transcript variants encoding distinct isoforms have been identified for this gene.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for the variably penetrant curly-tail mutation (ct) show symptoms of cranial or spinal neural tube defects such as curly tails and/or spina bifida; homozygotes with more severe phenotypes display exencephaly and die in utero. Homozygous knockout mice show severe neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 A G 17: 56,845,448 Y665H probably damaging Het
Agbl4 T A 4: 111,617,148 V378E probably benign Het
Card9 T C 2: 26,357,315 D274G probably benign Het
Ccnc T C 4: 21,747,578 probably null Het
Col1a2 T G 6: 4,533,847 S843A unknown Het
Cux1 T A 5: 136,373,397 I111F probably damaging Het
Fam24b A C 7: 131,326,140 S107A probably benign Het
Fndc7 C T 3: 108,867,145 C599Y probably damaging Het
Gm3604 G A 13: 62,369,869 A225V probably damaging Het
Gm498 T C 7: 143,891,791 S192P probably damaging Het
Heg1 T A 16: 33,730,525 V958E possibly damaging Het
Hibch T C 1: 52,860,038 M30T probably benign Het
Hist2h2ac A G 3: 96,220,790 S19P unknown Het
Hk2 T A 6: 82,728,809 M838L probably benign Het
Hpd A G 5: 123,176,234 F206S probably damaging Het
Il34 C T 8: 110,742,652 C177Y probably damaging Het
Il6ra A G 3: 89,912,953 probably null Het
Itpr2 A G 6: 146,187,490 I2240T probably damaging Het
Med24 A G 11: 98,718,495 probably null Het
Mpz A G 1: 171,160,033 D246G probably damaging Het
Ncam1 C A 9: 49,509,757 A753S probably benign Het
Ndufs2 A T 1: 171,236,694 M375K probably damaging Het
Obox2 A G 7: 15,397,220 K84E possibly damaging Het
Olfr1183 A G 2: 88,461,678 I132V probably benign Het
Olfr18 C T 9: 20,314,249 V224I probably benign Het
Olfr639 A G 7: 104,011,799 I301T probably damaging Het
Pds5a A T 5: 65,637,898 L665Q probably damaging Het
Prr29 A G 11: 106,376,273 E38G probably benign Het
Ptpn3 G C 4: 57,248,688 D215E probably benign Het
Ptprq G A 10: 107,652,616 Q987* probably null Het
Ranbp6 T C 19: 29,811,822 S377G possibly damaging Het
Rps6ka1 A T 4: 133,867,195 L168Q probably damaging Het
Sall1 A G 8: 89,032,543 I311T probably damaging Het
Satb2 T C 1: 56,891,231 Y211C probably damaging Het
Sis T A 3: 72,952,480 Y314F probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc6a20a T C 9: 123,660,592 N129D probably damaging Het
Slu7 G A 11: 43,446,148 R572Q probably benign Het
Tbx6 C T 7: 126,782,859 A123V possibly damaging Het
Tcn2 A T 11: 3,927,579 I23K possibly damaging Het
Tiparp A G 3: 65,531,803 D180G probably benign Het
Tln2 A G 9: 67,224,064 L1400P probably damaging Het
Ttf2 T C 3: 100,956,255 T588A probably benign Het
Ttn A G 2: 76,939,220 V2741A unknown Het
Txlna A T 4: 129,639,485 S83R probably damaging Het
Vmn2r16 C T 5: 109,340,406 Q382* probably null Het
Vmn2r76 A G 7: 86,229,820 V424A probably benign Het
Zfc3h1 T A 10: 115,420,648 L1508I probably damaging Het
Zfp189 G A 4: 49,530,312 G472R probably damaging Het
Zfp462 G A 4: 55,073,106 probably null Het
Other mutations in Grhl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02638:Grhl3 APN 4 135556865 missense probably benign 0.00
IGL02868:Grhl3 APN 4 135554604 missense probably damaging 1.00
Bite-size UTSW 4 135557433 missense possibly damaging 0.46
hammerkop UTSW 4 135546246 missense probably damaging 1.00
hoopoe UTSW 4 135559146 missense probably benign 0.00
R0121:Grhl3 UTSW 4 135552549 missense probably damaging 0.97
R0180:Grhl3 UTSW 4 135554530 missense probably benign 0.00
R0627:Grhl3 UTSW 4 135552681 missense probably benign 0.18
R0727:Grhl3 UTSW 4 135546254 missense possibly damaging 0.90
R1248:Grhl3 UTSW 4 135561306 missense probably benign 0.01
R1664:Grhl3 UTSW 4 135552550 missense probably benign 0.11
R2910:Grhl3 UTSW 4 135559146 missense probably benign 0.00
R2911:Grhl3 UTSW 4 135559146 missense probably benign 0.00
R3773:Grhl3 UTSW 4 135555847 nonsense probably null
R4033:Grhl3 UTSW 4 135573424 start codon destroyed probably benign
R4521:Grhl3 UTSW 4 135546250 missense probably damaging 1.00
R4576:Grhl3 UTSW 4 135561251 missense probably damaging 1.00
R4650:Grhl3 UTSW 4 135549236 splice site probably null
R4697:Grhl3 UTSW 4 135548466 missense probably damaging 1.00
R4919:Grhl3 UTSW 4 135559104 nonsense probably null
R4920:Grhl3 UTSW 4 135559104 nonsense probably null
R4961:Grhl3 UTSW 4 135552607 missense probably damaging 1.00
R5100:Grhl3 UTSW 4 135542675 missense probably benign
R5180:Grhl3 UTSW 4 135559104 nonsense probably null
R5181:Grhl3 UTSW 4 135559104 nonsense probably null
R5325:Grhl3 UTSW 4 135559104 nonsense probably null
R6429:Grhl3 UTSW 4 135557196 missense probably damaging 0.99
R6459:Grhl3 UTSW 4 135557433 missense possibly damaging 0.46
R7047:Grhl3 UTSW 4 135549240 splice site probably null
R7073:Grhl3 UTSW 4 135573412 missense probably benign 0.00
R7345:Grhl3 UTSW 4 135546246 missense probably damaging 1.00
R7797:Grhl3 UTSW 4 135559105 missense possibly damaging 0.93
R7829:Grhl3 UTSW 4 135561221 missense probably damaging 0.98
Z1177:Grhl3 UTSW 4 135552686 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCTGTATCCCCATCTCGGAG -3'
(R):5'- ATACTGCAGCAGTTCGGTTG -3'

Sequencing Primer
(F):5'- TTTCCATGTAAGGGAAGCCC -3'
(R):5'- CAGCAGTTCGGTTGTGTCCC -3'
Posted On2020-01-23