Incidental Mutation 'R8023:Hpd'
ID617523
Institutional Source Beutler Lab
Gene Symbol Hpd
Ensembl Gene ENSMUSG00000029445
Gene Name4-hydroxyphenylpyruvic acid dioxygenase
SynonymsLaf, Flp, Fla, Hppd
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R8023 (G1)
Quality Score202.009
Status Not validated
Chromosome5
Chromosomal Location123171807-123182727 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123176234 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 206 (F206S)
Ref Sequence ENSEMBL: ENSMUSP00000031398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031398] [ENSMUST00000154713]
Predicted Effect probably damaging
Transcript: ENSMUST00000031398
AA Change: F206S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031398
Gene: ENSMUSG00000029445
AA Change: F206S

DomainStartEndE-ValueType
Pfam:Glyoxalase 18 138 5.6e-10 PFAM
Pfam:Glyoxalase_4 20 134 7.7e-10 PFAM
Pfam:Glyoxalase_2 24 147 4.5e-9 PFAM
Pfam:Glyoxalase 180 335 2.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144679
SMART Domains Protein: ENSMUSP00000118702
Gene: ENSMUSG00000029445

DomainStartEndE-ValueType
PDB:1SQI|B 2 89 4e-51 PDB
SCOP:d1cjxa2 3 89 3e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154713
SMART Domains Protein: ENSMUSP00000121922
Gene: ENSMUSG00000029445

DomainStartEndE-ValueType
SCOP:d1cjxa1 1 122 3e-13 SMART
PDB:1SQI|B 1 159 1e-113 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme in the catabolic pathway of tyrosine. The encoded protein catalyzes the conversion of 4-hydroxyphenylpyruvate to homogentisate. Defects in this gene are a cause of tyrosinemia type 3 (TYRO3) and hawkinsinuria (HAWK). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
PHENOTYPE: CBA, C3H, DBA/2, SM and AKR have the F.1 form of this soluble liver antigen; A/J, A2G, BALB/c and C57BL/10 the F.2 form. F.2 antigen induces precipitating antibodies in F.1 but not F.2 strains and vice versa. F antigen immune response requires H2 Kk or Ak alleles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 A G 17: 56,845,448 Y665H probably damaging Het
Agbl4 T A 4: 111,617,148 V378E probably benign Het
Card9 T C 2: 26,357,315 D274G probably benign Het
Ccnc T C 4: 21,747,578 probably null Het
Col1a2 T G 6: 4,533,847 S843A unknown Het
Cux1 T A 5: 136,373,397 I111F probably damaging Het
Fam24b A C 7: 131,326,140 S107A probably benign Het
Fndc7 C T 3: 108,867,145 C599Y probably damaging Het
Gm3604 G A 13: 62,369,869 A225V probably damaging Het
Gm498 T C 7: 143,891,791 S192P probably damaging Het
Grhl3 A G 4: 135,550,329 V475A probably benign Het
Heg1 T A 16: 33,730,525 V958E possibly damaging Het
Hibch T C 1: 52,860,038 M30T probably benign Het
Hist2h2ac A G 3: 96,220,790 S19P unknown Het
Hk2 T A 6: 82,728,809 M838L probably benign Het
Il34 C T 8: 110,742,652 C177Y probably damaging Het
Il6ra A G 3: 89,912,953 probably null Het
Itpr2 A G 6: 146,187,490 I2240T probably damaging Het
Med24 A G 11: 98,718,495 probably null Het
Mpz A G 1: 171,160,033 D246G probably damaging Het
Ncam1 C A 9: 49,509,757 A753S probably benign Het
Ndufs2 A T 1: 171,236,694 M375K probably damaging Het
Obox2 A G 7: 15,397,220 K84E possibly damaging Het
Olfr1183 A G 2: 88,461,678 I132V probably benign Het
Olfr18 C T 9: 20,314,249 V224I probably benign Het
Olfr639 A G 7: 104,011,799 I301T probably damaging Het
Pds5a A T 5: 65,637,898 L665Q probably damaging Het
Prr29 A G 11: 106,376,273 E38G probably benign Het
Ptpn3 G C 4: 57,248,688 D215E probably benign Het
Ptprq G A 10: 107,652,616 Q987* probably null Het
Ranbp6 T C 19: 29,811,822 S377G possibly damaging Het
Rps6ka1 A T 4: 133,867,195 L168Q probably damaging Het
Sall1 A G 8: 89,032,543 I311T probably damaging Het
Satb2 T C 1: 56,891,231 Y211C probably damaging Het
Sis T A 3: 72,952,480 Y314F probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc6a20a T C 9: 123,660,592 N129D probably damaging Het
Slu7 G A 11: 43,446,148 R572Q probably benign Het
Tbx6 C T 7: 126,782,859 A123V possibly damaging Het
Tcn2 A T 11: 3,927,579 I23K possibly damaging Het
Tiparp A G 3: 65,531,803 D180G probably benign Het
Tln2 A G 9: 67,224,064 L1400P probably damaging Het
Ttf2 T C 3: 100,956,255 T588A probably benign Het
Ttn A G 2: 76,939,220 V2741A unknown Het
Txlna A T 4: 129,639,485 S83R probably damaging Het
Vmn2r16 C T 5: 109,340,406 Q382* probably null Het
Vmn2r76 A G 7: 86,229,820 V424A probably benign Het
Zfc3h1 T A 10: 115,420,648 L1508I probably damaging Het
Zfp189 G A 4: 49,530,312 G472R probably damaging Het
Zfp462 G A 4: 55,073,106 probably null Het
Other mutations in Hpd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02483:Hpd APN 5 123182578 splice site probably null
IGL02510:Hpd APN 5 123181910 missense possibly damaging 0.95
IGL02574:Hpd APN 5 123179357 splice site probably benign
IGL02642:Hpd APN 5 123181440 missense possibly damaging 0.86
IGL03374:Hpd APN 5 123172045 missense probably damaging 1.00
pyruvian UTSW 5 123178192 nonsense probably null
R0079:Hpd UTSW 5 123181481 missense probably damaging 1.00
R1022:Hpd UTSW 5 123174469 missense possibly damaging 0.94
R1024:Hpd UTSW 5 123174469 missense possibly damaging 0.94
R1165:Hpd UTSW 5 123176090 critical splice donor site probably null
R2414:Hpd UTSW 5 123177524 unclassified probably null
R6572:Hpd UTSW 5 123180676 missense probably benign 0.22
R6604:Hpd UTSW 5 123180901 unclassified probably null
R6616:Hpd UTSW 5 123172060 missense probably damaging 1.00
R7539:Hpd UTSW 5 123178192 nonsense probably null
R8086:Hpd UTSW 5 123176189 missense probably benign 0.20
R8134:Hpd UTSW 5 123174380 missense probably benign
X0023:Hpd UTSW 5 123174439 missense probably damaging 1.00
Z1176:Hpd UTSW 5 123181475 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCGCTCAGACCTATGCTCTC -3'
(R):5'- GTTACAAAACACTTCCCTTCCG -3'

Sequencing Primer
(F):5'- TCTCTCAGAGCCCGCAAG -3'
(R):5'- CTTCCGCTTAAAATCGTCAAAAG -3'
Posted On2020-01-23