Incidental Mutation 'R8023:Hk2'
ID617526
Institutional Source Beutler Lab
Gene Symbol Hk2
Ensembl Gene ENSMUSG00000000628
Gene Namehexokinase 2
SynonymsHKII
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8023 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location82725025-82774454 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82728809 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 838 (M838L)
Ref Sequence ENSEMBL: ENSMUSP00000000642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000642] [ENSMUST00000170833]
Predicted Effect probably benign
Transcript: ENSMUST00000000642
AA Change: M838L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000000642
Gene: ENSMUSG00000000628
AA Change: M838L

DomainStartEndE-ValueType
Pfam:Hexokinase_1 21 220 9.8e-78 PFAM
Pfam:Hexokinase_2 225 459 4.9e-85 PFAM
Pfam:Hexokinase_1 469 668 6.4e-80 PFAM
Pfam:Hexokinase_2 673 907 8.7e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170833
AA Change: M810L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000125986
Gene: ENSMUSG00000000628
AA Change: M810L

DomainStartEndE-ValueType
Pfam:Hexokinase_1 1 193 5.5e-89 PFAM
Pfam:Hexokinase_2 195 434 5.3e-107 PFAM
Pfam:Hexokinase_1 436 641 5.9e-91 PFAM
Pfam:Hexokinase_2 643 882 1.3e-109 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes hexokinase 2, the predominant form found in skeletal muscle. It localizes to the outer membrane of mitochondria. Expression of this gene is insulin-responsive, and studies in rat suggest that it is involved in the increased rate of glycolysis seen in rapidly growing cancer cells. [provided by RefSeq, Apr 2009]
PHENOTYPE: Embryos homozygous for a knock-out mutation are severely growth retarded and die around E8.5. Interestingly, heterozygous mutant mice are viable and fertile, develop normally and do not exhibit impaired insulin action or glucose tolerance even when challenged with a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 A G 17: 56,845,448 Y665H probably damaging Het
Agbl4 T A 4: 111,617,148 V378E probably benign Het
Card9 T C 2: 26,357,315 D274G probably benign Het
Ccnc T C 4: 21,747,578 probably null Het
Col1a2 T G 6: 4,533,847 S843A unknown Het
Cux1 T A 5: 136,373,397 I111F probably damaging Het
Fam24b A C 7: 131,326,140 S107A probably benign Het
Fndc7 C T 3: 108,867,145 C599Y probably damaging Het
Gm3604 G A 13: 62,369,869 A225V probably damaging Het
Gm498 T C 7: 143,891,791 S192P probably damaging Het
Grhl3 A G 4: 135,550,329 V475A probably benign Het
Heg1 T A 16: 33,730,525 V958E possibly damaging Het
Hibch T C 1: 52,860,038 M30T probably benign Het
Hist2h2ac A G 3: 96,220,790 S19P unknown Het
Hpd A G 5: 123,176,234 F206S probably damaging Het
Il34 C T 8: 110,742,652 C177Y probably damaging Het
Il6ra A G 3: 89,912,953 probably null Het
Itpr2 A G 6: 146,187,490 I2240T probably damaging Het
Med24 A G 11: 98,718,495 probably null Het
Mpz A G 1: 171,160,033 D246G probably damaging Het
Ncam1 C A 9: 49,509,757 A753S probably benign Het
Ndufs2 A T 1: 171,236,694 M375K probably damaging Het
Obox2 A G 7: 15,397,220 K84E possibly damaging Het
Olfr1183 A G 2: 88,461,678 I132V probably benign Het
Olfr18 C T 9: 20,314,249 V224I probably benign Het
Olfr639 A G 7: 104,011,799 I301T probably damaging Het
Pds5a A T 5: 65,637,898 L665Q probably damaging Het
Prr29 A G 11: 106,376,273 E38G probably benign Het
Ptpn3 G C 4: 57,248,688 D215E probably benign Het
Ptprq G A 10: 107,652,616 Q987* probably null Het
Ranbp6 T C 19: 29,811,822 S377G possibly damaging Het
Rps6ka1 A T 4: 133,867,195 L168Q probably damaging Het
Sall1 A G 8: 89,032,543 I311T probably damaging Het
Satb2 T C 1: 56,891,231 Y211C probably damaging Het
Sis T A 3: 72,952,480 Y314F probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc6a20a T C 9: 123,660,592 N129D probably damaging Het
Slu7 G A 11: 43,446,148 R572Q probably benign Het
Tbx6 C T 7: 126,782,859 A123V possibly damaging Het
Tcn2 A T 11: 3,927,579 I23K possibly damaging Het
Tiparp A G 3: 65,531,803 D180G probably benign Het
Tln2 A G 9: 67,224,064 L1400P probably damaging Het
Ttf2 T C 3: 100,956,255 T588A probably benign Het
Ttn A G 2: 76,939,220 V2741A unknown Het
Txlna A T 4: 129,639,485 S83R probably damaging Het
Vmn2r16 C T 5: 109,340,406 Q382* probably null Het
Vmn2r76 A G 7: 86,229,820 V424A probably benign Het
Zfc3h1 T A 10: 115,420,648 L1508I probably damaging Het
Zfp189 G A 4: 49,530,312 G472R probably damaging Het
Zfp462 G A 4: 55,073,106 probably null Het
Other mutations in Hk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Hk2 APN 6 82729552 missense possibly damaging 0.93
IGL01484:Hk2 APN 6 82736730 missense probably damaging 1.00
IGL01786:Hk2 APN 6 82739553 missense probably benign 0.13
IGL02164:Hk2 APN 6 82743939 splice site probably null
IGL02293:Hk2 APN 6 82743975 missense probably benign 0.00
IGL02861:Hk2 APN 6 82760158 missense possibly damaging 0.73
IGL03029:Hk2 APN 6 82738333 missense probably damaging 1.00
IGL03063:Hk2 APN 6 82739649 missense probably damaging 1.00
IGL03063:Hk2 APN 6 82749232 missense probably benign 0.23
IGL02799:Hk2 UTSW 6 82760238 missense probably damaging 1.00
PIT4243001:Hk2 UTSW 6 82730877 missense probably damaging 1.00
R0069:Hk2 UTSW 6 82736528 critical splice donor site probably null
R0081:Hk2 UTSW 6 82734976 splice site probably benign
R0981:Hk2 UTSW 6 82743968 missense probably damaging 1.00
R1234:Hk2 UTSW 6 82760248 missense possibly damaging 0.95
R1239:Hk2 UTSW 6 82749308 missense probably damaging 1.00
R1695:Hk2 UTSW 6 82744951 missense probably damaging 0.99
R1891:Hk2 UTSW 6 82749283 missense probably benign 0.01
R2338:Hk2 UTSW 6 82731115 missense probably damaging 1.00
R3854:Hk2 UTSW 6 82736676 missense possibly damaging 0.87
R3855:Hk2 UTSW 6 82736676 missense possibly damaging 0.87
R3856:Hk2 UTSW 6 82736676 missense possibly damaging 0.87
R3887:Hk2 UTSW 6 82734961 missense possibly damaging 0.72
R4382:Hk2 UTSW 6 82735341 missense probably null 1.00
R4684:Hk2 UTSW 6 82739648 missense probably damaging 1.00
R4705:Hk2 UTSW 6 82739650 missense possibly damaging 0.95
R4735:Hk2 UTSW 6 82744974 missense probably benign 0.40
R5014:Hk2 UTSW 6 82743955 missense possibly damaging 0.73
R5552:Hk2 UTSW 6 82730823 missense possibly damaging 0.87
R5914:Hk2 UTSW 6 82736634 missense probably benign
R6212:Hk2 UTSW 6 82728842 missense probably benign 0.02
R6276:Hk2 UTSW 6 82743366 missense probably benign 0.05
R6369:Hk2 UTSW 6 82736753 missense probably damaging 1.00
R7175:Hk2 UTSW 6 82734849 missense probably benign 0.00
R7340:Hk2 UTSW 6 82728892 missense probably benign 0.00
R7383:Hk2 UTSW 6 82749295 missense probably damaging 1.00
R7417:Hk2 UTSW 6 82743345 missense probably damaging 1.00
R7481:Hk2 UTSW 6 82760169 missense probably benign 0.09
R7495:Hk2 UTSW 6 82727365 missense probably damaging 1.00
R7757:Hk2 UTSW 6 82742915 missense possibly damaging 0.88
R8100:Hk2 UTSW 6 82730878 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- AGCCAGCAAAAGGGTCATC -3'
(R):5'- CGCATTATTCACCGTGCACTG -3'

Sequencing Primer
(F):5'- AGCACTAAACCCTCTTTGGAGTGG -3'
(R):5'- ACTGTCCATCTCCCACGCAG -3'
Posted On2020-01-23