Incidental Mutation 'R8023:Vmn2r76'
ID617529
Institutional Source Beutler Lab
Gene Symbol Vmn2r76
Ensembl Gene ENSMUSG00000091239
Gene Namevomeronasal 2, receptor 76
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R8023 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location86225206-86246201 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86229820 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 424 (V424A)
Ref Sequence ENSEMBL: ENSMUSP00000127309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165771]
Predicted Effect probably benign
Transcript: ENSMUST00000165771
AA Change: V424A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000127309
Gene: ENSMUSG00000091239
AA Change: V424A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 78 470 1.2e-29 PFAM
low complexity region 476 489 N/A INTRINSIC
Pfam:NCD3G 513 565 3.7e-22 PFAM
Pfam:7tm_3 598 833 1.4e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 A G 17: 56,845,448 Y665H probably damaging Het
Agbl4 T A 4: 111,617,148 V378E probably benign Het
Card9 T C 2: 26,357,315 D274G probably benign Het
Ccnc T C 4: 21,747,578 probably null Het
Col1a2 T G 6: 4,533,847 S843A unknown Het
Cux1 T A 5: 136,373,397 I111F probably damaging Het
Fam24b A C 7: 131,326,140 S107A probably benign Het
Fndc7 C T 3: 108,867,145 C599Y probably damaging Het
Gm3604 G A 13: 62,369,869 A225V probably damaging Het
Gm498 T C 7: 143,891,791 S192P probably damaging Het
Grhl3 A G 4: 135,550,329 V475A probably benign Het
Heg1 T A 16: 33,730,525 V958E possibly damaging Het
Hibch T C 1: 52,860,038 M30T probably benign Het
Hist2h2ac A G 3: 96,220,790 S19P unknown Het
Hk2 T A 6: 82,728,809 M838L probably benign Het
Hpd A G 5: 123,176,234 F206S probably damaging Het
Il34 C T 8: 110,742,652 C177Y probably damaging Het
Il6ra A G 3: 89,912,953 probably null Het
Itpr2 A G 6: 146,187,490 I2240T probably damaging Het
Med24 A G 11: 98,718,495 probably null Het
Mpz A G 1: 171,160,033 D246G probably damaging Het
Ncam1 C A 9: 49,509,757 A753S probably benign Het
Ndufs2 A T 1: 171,236,694 M375K probably damaging Het
Obox2 A G 7: 15,397,220 K84E possibly damaging Het
Olfr1183 A G 2: 88,461,678 I132V probably benign Het
Olfr18 C T 9: 20,314,249 V224I probably benign Het
Olfr639 A G 7: 104,011,799 I301T probably damaging Het
Pds5a A T 5: 65,637,898 L665Q probably damaging Het
Prr29 A G 11: 106,376,273 E38G probably benign Het
Ptpn3 G C 4: 57,248,688 D215E probably benign Het
Ptprq G A 10: 107,652,616 Q987* probably null Het
Ranbp6 T C 19: 29,811,822 S377G possibly damaging Het
Rps6ka1 A T 4: 133,867,195 L168Q probably damaging Het
Sall1 A G 8: 89,032,543 I311T probably damaging Het
Satb2 T C 1: 56,891,231 Y211C probably damaging Het
Sis T A 3: 72,952,480 Y314F probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc6a20a T C 9: 123,660,592 N129D probably damaging Het
Slu7 G A 11: 43,446,148 R572Q probably benign Het
Tbx6 C T 7: 126,782,859 A123V possibly damaging Het
Tcn2 A T 11: 3,927,579 I23K possibly damaging Het
Tiparp A G 3: 65,531,803 D180G probably benign Het
Tln2 A G 9: 67,224,064 L1400P probably damaging Het
Ttf2 T C 3: 100,956,255 T588A probably benign Het
Ttn A G 2: 76,939,220 V2741A unknown Het
Txlna A T 4: 129,639,485 S83R probably damaging Het
Vmn2r16 C T 5: 109,340,406 Q382* probably null Het
Zfc3h1 T A 10: 115,420,648 L1508I probably damaging Het
Zfp189 G A 4: 49,530,312 G472R probably damaging Het
Zfp462 G A 4: 55,073,106 probably null Het
Other mutations in Vmn2r76
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Vmn2r76 APN 7 86228717 missense probably benign
IGL01374:Vmn2r76 APN 7 86225649 missense probably benign 0.02
IGL01419:Vmn2r76 APN 7 86225702 missense probably benign 0.32
IGL01627:Vmn2r76 APN 7 86225663 missense probably damaging 1.00
IGL01730:Vmn2r76 APN 7 86230198 missense probably benign 0.02
IGL01957:Vmn2r76 APN 7 86228717 missense probably benign
IGL02214:Vmn2r76 APN 7 86229930 missense probably benign 0.07
IGL02489:Vmn2r76 APN 7 86228863 missense probably benign 0.41
IGL02543:Vmn2r76 APN 7 86230148 missense probably benign 0.06
IGL02579:Vmn2r76 APN 7 86228753 nonsense probably null
IGL02598:Vmn2r76 APN 7 86228671 missense probably benign 0.05
IGL02720:Vmn2r76 APN 7 86225706 missense probably benign 0.35
IGL02745:Vmn2r76 APN 7 86230287 missense probably benign 0.06
IGL03393:Vmn2r76 APN 7 86229826 missense probably benign 0.01
R0483:Vmn2r76 UTSW 7 86225751 missense probably damaging 1.00
R0513:Vmn2r76 UTSW 7 86228779 missense probably benign 0.01
R0528:Vmn2r76 UTSW 7 86230298 missense possibly damaging 0.80
R0601:Vmn2r76 UTSW 7 86226115 critical splice acceptor site probably null
R0662:Vmn2r76 UTSW 7 86230370 missense probably benign 0.39
R0883:Vmn2r76 UTSW 7 86228696 missense probably benign 0.00
R1532:Vmn2r76 UTSW 7 86230246 missense probably benign 0.02
R1694:Vmn2r76 UTSW 7 86230148 missense probably benign 0.06
R1696:Vmn2r76 UTSW 7 86231256 missense possibly damaging 0.56
R2135:Vmn2r76 UTSW 7 86231011 missense probably benign 0.02
R2151:Vmn2r76 UTSW 7 86230484 missense probably benign
R2181:Vmn2r76 UTSW 7 86225535 missense probably benign 0.00
R2268:Vmn2r76 UTSW 7 86230499 missense probably benign 0.03
R2877:Vmn2r76 UTSW 7 86225993 missense probably benign 0.00
R3155:Vmn2r76 UTSW 7 86225751 missense probably damaging 1.00
R3746:Vmn2r76 UTSW 7 86225555 missense probably benign 0.11
R3799:Vmn2r76 UTSW 7 86226036 missense probably benign 0.00
R3825:Vmn2r76 UTSW 7 86231207 missense probably benign 0.10
R4058:Vmn2r76 UTSW 7 86230300 missense probably benign 0.00
R4237:Vmn2r76 UTSW 7 86230532 missense probably benign 0.00
R4404:Vmn2r76 UTSW 7 86228303 missense probably benign 0.16
R4796:Vmn2r76 UTSW 7 86230444 missense possibly damaging 0.95
R4838:Vmn2r76 UTSW 7 86225525 missense probably damaging 1.00
R5175:Vmn2r76 UTSW 7 86228707 missense probably benign 0.00
R5268:Vmn2r76 UTSW 7 86226059 missense probably damaging 1.00
R5381:Vmn2r76 UTSW 7 86225288 missense probably damaging 1.00
R5531:Vmn2r76 UTSW 7 86225449 missense probably damaging 1.00
R5566:Vmn2r76 UTSW 7 86226078 missense probably damaging 1.00
R5646:Vmn2r76 UTSW 7 86226053 missense probably damaging 0.98
R5664:Vmn2r76 UTSW 7 86245994 critical splice donor site probably null
R5818:Vmn2r76 UTSW 7 86229934 missense probably benign 0.00
R6093:Vmn2r76 UTSW 7 86228261 nonsense probably null
R6651:Vmn2r76 UTSW 7 86228851 missense possibly damaging 0.64
R6741:Vmn2r76 UTSW 7 86230352 missense probably benign
R6750:Vmn2r76 UTSW 7 86225906 missense probably damaging 1.00
R7082:Vmn2r76 UTSW 7 86225232 missense probably benign 0.01
R7136:Vmn2r76 UTSW 7 86228767 missense probably benign 0.06
R7524:Vmn2r76 UTSW 7 86225369 missense probably benign 0.22
R7524:Vmn2r76 UTSW 7 86230166 missense probably benign 0.00
R7611:Vmn2r76 UTSW 7 86230180 missense probably benign 0.04
R7833:Vmn2r76 UTSW 7 86228684 missense probably benign
R7916:Vmn2r76 UTSW 7 86228684 missense probably benign
R8002:Vmn2r76 UTSW 7 86230063 missense probably benign 0.05
R8021:Vmn2r76 UTSW 7 86225750 missense probably damaging 1.00
Z1176:Vmn2r76 UTSW 7 86246063 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- GAGCAAAACATTCCTAGATACTTGG -3'
(R):5'- GAATTTATACAGACAGCGCACC -3'

Sequencing Primer
(F):5'- CTTCAAAGGTTCTACATTGATCGTC -3'
(R):5'- GCGCACCCTTTAAACTACAG -3'
Posted On2020-01-23