Incidental Mutation 'R8023:Gm498'
ID617533
Institutional Source Beutler Lab
Gene Symbol Gm498
Ensembl Gene ENSMUSG00000031085
Gene Namepredicted gene 498
SynonymsLOC244239
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R8023 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location143866838-143900046 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143891791 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 192 (S192P)
Ref Sequence ENSEMBL: ENSMUSP00000115809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134455] [ENSMUST00000152910] [ENSMUST00000179036] [ENSMUST00000207235] [ENSMUST00000207482] [ENSMUST00000207630] [ENSMUST00000207642] [ENSMUST00000208038] [ENSMUST00000208153] [ENSMUST00000208457] [ENSMUST00000208625] [ENSMUST00000208761]
Predicted Effect probably benign
Transcript: ENSMUST00000134455
Predicted Effect probably damaging
Transcript: ENSMUST00000152910
AA Change: S192P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115809
Gene: ENSMUSG00000031085
AA Change: S192P

DomainStartEndE-ValueType
ACTIN 3 372 1.94e-125 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179036
AA Change: S194P

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137404
Gene: ENSMUSG00000031085
AA Change: S194P

DomainStartEndE-ValueType
ACTIN 5 330 1.4e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207235
Predicted Effect probably benign
Transcript: ENSMUST00000207482
Predicted Effect probably damaging
Transcript: ENSMUST00000207630
AA Change: S190P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000207642
Predicted Effect probably benign
Transcript: ENSMUST00000208038
Predicted Effect probably benign
Transcript: ENSMUST00000208153
Predicted Effect probably benign
Transcript: ENSMUST00000208457
Predicted Effect probably benign
Transcript: ENSMUST00000208625
Predicted Effect probably benign
Transcript: ENSMUST00000208761
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 A G 17: 56,845,448 Y665H probably damaging Het
Agbl4 T A 4: 111,617,148 V378E probably benign Het
Card9 T C 2: 26,357,315 D274G probably benign Het
Ccnc T C 4: 21,747,578 probably null Het
Col1a2 T G 6: 4,533,847 S843A unknown Het
Cux1 T A 5: 136,373,397 I111F probably damaging Het
Fam24b A C 7: 131,326,140 S107A probably benign Het
Fndc7 C T 3: 108,867,145 C599Y probably damaging Het
Gm3604 G A 13: 62,369,869 A225V probably damaging Het
Grhl3 A G 4: 135,550,329 V475A probably benign Het
Heg1 T A 16: 33,730,525 V958E possibly damaging Het
Hibch T C 1: 52,860,038 M30T probably benign Het
Hist2h2ac A G 3: 96,220,790 S19P unknown Het
Hk2 T A 6: 82,728,809 M838L probably benign Het
Hpd A G 5: 123,176,234 F206S probably damaging Het
Il34 C T 8: 110,742,652 C177Y probably damaging Het
Il6ra A G 3: 89,912,953 probably null Het
Itpr2 A G 6: 146,187,490 I2240T probably damaging Het
Med24 A G 11: 98,718,495 probably null Het
Mpz A G 1: 171,160,033 D246G probably damaging Het
Ncam1 C A 9: 49,509,757 A753S probably benign Het
Ndufs2 A T 1: 171,236,694 M375K probably damaging Het
Obox2 A G 7: 15,397,220 K84E possibly damaging Het
Olfr1183 A G 2: 88,461,678 I132V probably benign Het
Olfr18 C T 9: 20,314,249 V224I probably benign Het
Olfr639 A G 7: 104,011,799 I301T probably damaging Het
Pds5a A T 5: 65,637,898 L665Q probably damaging Het
Prr29 A G 11: 106,376,273 E38G probably benign Het
Ptpn3 G C 4: 57,248,688 D215E probably benign Het
Ptprq G A 10: 107,652,616 Q987* probably null Het
Ranbp6 T C 19: 29,811,822 S377G possibly damaging Het
Rps6ka1 A T 4: 133,867,195 L168Q probably damaging Het
Sall1 A G 8: 89,032,543 I311T probably damaging Het
Satb2 T C 1: 56,891,231 Y211C probably damaging Het
Sis T A 3: 72,952,480 Y314F probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc6a20a T C 9: 123,660,592 N129D probably damaging Het
Slu7 G A 11: 43,446,148 R572Q probably benign Het
Tbx6 C T 7: 126,782,859 A123V possibly damaging Het
Tcn2 A T 11: 3,927,579 I23K possibly damaging Het
Tiparp A G 3: 65,531,803 D180G probably benign Het
Tln2 A G 9: 67,224,064 L1400P probably damaging Het
Ttf2 T C 3: 100,956,255 T588A probably benign Het
Ttn A G 2: 76,939,220 V2741A unknown Het
Txlna A T 4: 129,639,485 S83R probably damaging Het
Vmn2r16 C T 5: 109,340,406 Q382* probably null Het
Vmn2r76 A G 7: 86,229,820 V424A probably benign Het
Zfc3h1 T A 10: 115,420,648 L1508I probably damaging Het
Zfp189 G A 4: 49,530,312 G472R probably damaging Het
Zfp462 G A 4: 55,073,106 probably null Het
Other mutations in Gm498
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02202:Gm498 APN 7 143894173 missense possibly damaging 0.71
R0128:Gm498 UTSW 7 143891755 missense probably damaging 1.00
R0217:Gm498 UTSW 7 143894219 splice site probably benign
R0726:Gm498 UTSW 7 143871761 missense probably damaging 0.99
R1025:Gm498 UTSW 7 143896390 missense probably damaging 0.99
R2879:Gm498 UTSW 7 143894063 nonsense probably null
R2925:Gm498 UTSW 7 143883999 nonsense probably null
R3625:Gm498 UTSW 7 143871854 missense possibly damaging 0.71
R4003:Gm498 UTSW 7 143897303 missense probably benign 0.16
R4184:Gm498 UTSW 7 143894121 nonsense probably null
R4205:Gm498 UTSW 7 143869227 missense probably damaging 0.99
R6179:Gm498 UTSW 7 143871787 missense probably benign 0.12
R7170:Gm498 UTSW 7 143896365 missense probably damaging 0.97
R8109:Gm498 UTSW 7 143897466 splice site probably null
R8120:Gm498 UTSW 7 143871787 missense probably benign 0.12
R8309:Gm498 UTSW 7 143883943 missense possibly damaging 0.95
R8516:Gm498 UTSW 7 143897274 missense probably damaging 0.98
R8748:Gm498 UTSW 7 143891819 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCACCAAGGCATGCTGTGTAC -3'
(R):5'- TATCCTCATAGGCAAGCCCC -3'

Sequencing Primer
(F):5'- GCTGTGTACCCCCACATCATAATG -3'
(R):5'- TTGAAACCCTGTCTCAAAAGAGATGG -3'
Posted On2020-01-23