Incidental Mutation 'R8023:Il34'
ID617535
Institutional Source Beutler Lab
Gene Symbol Il34
Ensembl Gene ENSMUSG00000031750
Gene Nameinterleukin 34
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R8023 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location110741829-110805924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 110742652 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 177 (C177Y)
Ref Sequence ENSEMBL: ENSMUSP00000076120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052457] [ENSMUST00000076846] [ENSMUST00000144041] [ENSMUST00000150680]
Predicted Effect probably benign
Transcript: ENSMUST00000052457
SMART Domains Protein: ENSMUSP00000050211
Gene: ENSMUSG00000033763

DomainStartEndE-ValueType
Pfam:IMD 15 236 8.1e-108 PFAM
low complexity region 252 274 N/A INTRINSIC
low complexity region 284 295 N/A INTRINSIC
low complexity region 312 330 N/A INTRINSIC
low complexity region 368 386 N/A INTRINSIC
low complexity region 429 442 N/A INTRINSIC
low complexity region 546 562 N/A INTRINSIC
low complexity region 668 690 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000076846
AA Change: C177Y

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076120
Gene: ENSMUSG00000031750
AA Change: C177Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:IL34 28 184 2e-79 PFAM
low complexity region 219 235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141302
SMART Domains Protein: ENSMUSP00000116518
Gene: ENSMUSG00000033763

DomainStartEndE-ValueType
Pfam:IMD 1 122 1e-56 PFAM
low complexity region 138 179 N/A INTRINSIC
low complexity region 202 213 N/A INTRINSIC
low complexity region 230 248 N/A INTRINSIC
low complexity region 286 304 N/A INTRINSIC
low complexity region 347 360 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144041
SMART Domains Protein: ENSMUSP00000115220
Gene: ENSMUSG00000033763

DomainStartEndE-ValueType
Pfam:IMD 1 174 3.6e-72 PFAM
low complexity region 190 212 N/A INTRINSIC
low complexity region 222 233 N/A INTRINSIC
low complexity region 250 268 N/A INTRINSIC
low complexity region 306 324 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
low complexity region 484 500 N/A INTRINSIC
low complexity region 606 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149273
SMART Domains Protein: ENSMUSP00000119495
Gene: ENSMUSG00000033763

DomainStartEndE-ValueType
Pfam:IMD 1 126 2.5e-59 PFAM
low complexity region 142 183 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 239 249 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000150680
SMART Domains Protein: ENSMUSP00000114398
Gene: ENSMUSG00000031750

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:IL34 23 155 4.6e-64 PFAM
low complexity region 197 208 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interleukin-34 is a cytokine that promotes the differentiation and viability of monocytes and macrophages through the colony-stimulating factor-1 receptor (CSF1R; MIM 164770) (Lin et al., 2008 [PubMed 18467591]).[supplied by OMIM, May 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced Langerhans cells and microglial cells in the skin and brain, respectively, with decreased susceptibility to type IV hypersensitivity reaction and fungal infection but increased susceptibility to viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 A G 17: 56,845,448 Y665H probably damaging Het
Agbl4 T A 4: 111,617,148 V378E probably benign Het
Card9 T C 2: 26,357,315 D274G probably benign Het
Ccnc T C 4: 21,747,578 probably null Het
Col1a2 T G 6: 4,533,847 S843A unknown Het
Cux1 T A 5: 136,373,397 I111F probably damaging Het
Fam24b A C 7: 131,326,140 S107A probably benign Het
Fndc7 C T 3: 108,867,145 C599Y probably damaging Het
Gm3604 G A 13: 62,369,869 A225V probably damaging Het
Gm498 T C 7: 143,891,791 S192P probably damaging Het
Grhl3 A G 4: 135,550,329 V475A probably benign Het
Heg1 T A 16: 33,730,525 V958E possibly damaging Het
Hibch T C 1: 52,860,038 M30T probably benign Het
Hist2h2ac A G 3: 96,220,790 S19P unknown Het
Hk2 T A 6: 82,728,809 M838L probably benign Het
Hpd A G 5: 123,176,234 F206S probably damaging Het
Il6ra A G 3: 89,912,953 probably null Het
Itpr2 A G 6: 146,187,490 I2240T probably damaging Het
Med24 A G 11: 98,718,495 probably null Het
Mpz A G 1: 171,160,033 D246G probably damaging Het
Ncam1 C A 9: 49,509,757 A753S probably benign Het
Ndufs2 A T 1: 171,236,694 M375K probably damaging Het
Obox2 A G 7: 15,397,220 K84E possibly damaging Het
Olfr1183 A G 2: 88,461,678 I132V probably benign Het
Olfr18 C T 9: 20,314,249 V224I probably benign Het
Olfr639 A G 7: 104,011,799 I301T probably damaging Het
Pds5a A T 5: 65,637,898 L665Q probably damaging Het
Prr29 A G 11: 106,376,273 E38G probably benign Het
Ptpn3 G C 4: 57,248,688 D215E probably benign Het
Ptprq G A 10: 107,652,616 Q987* probably null Het
Ranbp6 T C 19: 29,811,822 S377G possibly damaging Het
Rps6ka1 A T 4: 133,867,195 L168Q probably damaging Het
Sall1 A G 8: 89,032,543 I311T probably damaging Het
Satb2 T C 1: 56,891,231 Y211C probably damaging Het
Sis T A 3: 72,952,480 Y314F probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc6a20a T C 9: 123,660,592 N129D probably damaging Het
Slu7 G A 11: 43,446,148 R572Q probably benign Het
Tbx6 C T 7: 126,782,859 A123V possibly damaging Het
Tcn2 A T 11: 3,927,579 I23K possibly damaging Het
Tiparp A G 3: 65,531,803 D180G probably benign Het
Tln2 A G 9: 67,224,064 L1400P probably damaging Het
Ttf2 T C 3: 100,956,255 T588A probably benign Het
Ttn A G 2: 76,939,220 V2741A unknown Het
Txlna A T 4: 129,639,485 S83R probably damaging Het
Vmn2r16 C T 5: 109,340,406 Q382* probably null Het
Vmn2r76 A G 7: 86,229,820 V424A probably benign Het
Zfc3h1 T A 10: 115,420,648 L1508I probably damaging Het
Zfp189 G A 4: 49,530,312 G472R probably damaging Het
Zfp462 G A 4: 55,073,106 probably null Het
Other mutations in Il34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Il34 APN 8 110742743 missense possibly damaging 0.83
IGL01420:Il34 APN 8 110742713 missense probably damaging 1.00
R0525:Il34 UTSW 8 110748283 missense probably damaging 1.00
R5830:Il34 UTSW 8 110748691 missense probably damaging 1.00
R5978:Il34 UTSW 8 110742685 missense probably damaging 1.00
R6189:Il34 UTSW 8 110742718 missense probably benign 0.00
R6552:Il34 UTSW 8 110742427 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGCTTTGTTTACCTGCAAGAAAC -3'
(R):5'- ATTTTGTTGAGACAGCCGCC -3'

Sequencing Primer
(F):5'- TGTTTACCTGCAAGAAACAGAAG -3'
(R):5'- AGACAGCCGCCATGGTTCTC -3'
Posted On2020-01-23