Incidental Mutation 'R8023:Olfr18'
ID617536
Institutional Source Beutler Lab
Gene Symbol Olfr18
Ensembl Gene ENSMUSG00000066896
Gene Nameolfactory receptor 18
SynonymsGA_x6K02T2PVTD-14054886-14053957, MOR145-1, MTPCR34
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8023 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location20312152-20336094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20314249 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 224 (V224I)
Ref Sequence ENSEMBL: ENSMUSP00000083664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086473] [ENSMUST00000212943]
Predicted Effect probably benign
Transcript: ENSMUST00000086473
AA Change: V224I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000083664
Gene: ENSMUSG00000066896
AA Change: V224I

DomainStartEndE-ValueType
Pfam:7tm_4 53 330 1.2e-54 PFAM
Pfam:7TM_GPCR_Srsx 57 234 3.2e-9 PFAM
Pfam:7tm_1 63 312 4.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212943
AA Change: V216I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 A G 17: 56,845,448 Y665H probably damaging Het
Agbl4 T A 4: 111,617,148 V378E probably benign Het
Card9 T C 2: 26,357,315 D274G probably benign Het
Ccnc T C 4: 21,747,578 probably null Het
Col1a2 T G 6: 4,533,847 S843A unknown Het
Cux1 T A 5: 136,373,397 I111F probably damaging Het
Fam24b A C 7: 131,326,140 S107A probably benign Het
Fndc7 C T 3: 108,867,145 C599Y probably damaging Het
Gm3604 G A 13: 62,369,869 A225V probably damaging Het
Gm498 T C 7: 143,891,791 S192P probably damaging Het
Grhl3 A G 4: 135,550,329 V475A probably benign Het
Heg1 T A 16: 33,730,525 V958E possibly damaging Het
Hibch T C 1: 52,860,038 M30T probably benign Het
Hist2h2ac A G 3: 96,220,790 S19P unknown Het
Hk2 T A 6: 82,728,809 M838L probably benign Het
Hpd A G 5: 123,176,234 F206S probably damaging Het
Il34 C T 8: 110,742,652 C177Y probably damaging Het
Il6ra A G 3: 89,912,953 probably null Het
Itpr2 A G 6: 146,187,490 I2240T probably damaging Het
Med24 A G 11: 98,718,495 probably null Het
Mpz A G 1: 171,160,033 D246G probably damaging Het
Ncam1 C A 9: 49,509,757 A753S probably benign Het
Ndufs2 A T 1: 171,236,694 M375K probably damaging Het
Obox2 A G 7: 15,397,220 K84E possibly damaging Het
Olfr1183 A G 2: 88,461,678 I132V probably benign Het
Olfr639 A G 7: 104,011,799 I301T probably damaging Het
Pds5a A T 5: 65,637,898 L665Q probably damaging Het
Prr29 A G 11: 106,376,273 E38G probably benign Het
Ptpn3 G C 4: 57,248,688 D215E probably benign Het
Ptprq G A 10: 107,652,616 Q987* probably null Het
Ranbp6 T C 19: 29,811,822 S377G possibly damaging Het
Rps6ka1 A T 4: 133,867,195 L168Q probably damaging Het
Sall1 A G 8: 89,032,543 I311T probably damaging Het
Satb2 T C 1: 56,891,231 Y211C probably damaging Het
Sis T A 3: 72,952,480 Y314F probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc6a20a T C 9: 123,660,592 N129D probably damaging Het
Slu7 G A 11: 43,446,148 R572Q probably benign Het
Tbx6 C T 7: 126,782,859 A123V possibly damaging Het
Tcn2 A T 11: 3,927,579 I23K possibly damaging Het
Tiparp A G 3: 65,531,803 D180G probably benign Het
Tln2 A G 9: 67,224,064 L1400P probably damaging Het
Ttf2 T C 3: 100,956,255 T588A probably benign Het
Ttn A G 2: 76,939,220 V2741A unknown Het
Txlna A T 4: 129,639,485 S83R probably damaging Het
Vmn2r16 C T 5: 109,340,406 Q382* probably null Het
Vmn2r76 A G 7: 86,229,820 V424A probably benign Het
Zfc3h1 T A 10: 115,420,648 L1508I probably damaging Het
Zfp189 G A 4: 49,530,312 G472R probably damaging Het
Zfp462 G A 4: 55,073,106 probably null Het
Other mutations in Olfr18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01992:Olfr18 APN 9 20314719 missense probably damaging 1.00
IGL02412:Olfr18 APN 9 20314639 missense probably benign
IGL03288:Olfr18 APN 9 20335911 critical splice donor site probably null
IGL03395:Olfr18 APN 9 20314551 missense probably damaging 1.00
R0332:Olfr18 UTSW 9 20314056 missense probably benign 0.00
R0346:Olfr18 UTSW 9 20314411 missense probably benign 0.20
R0569:Olfr18 UTSW 9 20314579 missense probably damaging 1.00
R0798:Olfr18 UTSW 9 20314199 nonsense probably null
R0865:Olfr18 UTSW 9 20314749 missense probably damaging 1.00
R1082:Olfr18 UTSW 9 20314469 missense possibly damaging 0.52
R1905:Olfr18 UTSW 9 20314846 missense probably benign
R4245:Olfr18 UTSW 9 20314333 missense possibly damaging 0.87
R5566:Olfr18 UTSW 9 20313969 missense probably benign
R6306:Olfr18 UTSW 9 20314446 missense probably benign 0.25
R6721:Olfr18 UTSW 9 20314280 missense probably benign 0.24
R6787:Olfr18 UTSW 9 20335925 missense probably benign
R6930:Olfr18 UTSW 9 20314099 missense probably damaging 1.00
R7196:Olfr18 UTSW 9 20314198 missense probably benign 0.38
R7711:Olfr18 UTSW 9 20314023 missense possibly damaging 0.66
R8029:Olfr18 UTSW 9 20314347 missense possibly damaging 0.59
R8050:Olfr18 UTSW 9 20314645 missense probably damaging 1.00
R8058:Olfr18 UTSW 9 20314180 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCCTGGGAGACAAGGACACAG -3'
(R):5'- TGAACCCTCGTCTTTGTGGC -3'

Sequencing Primer
(F):5'- GCTGAACTGAGGTATACCCC -3'
(R):5'- CCCTCGTCTTTGTGGCTTGTTG -3'
Posted On2020-01-23