Incidental Mutation 'R8023:Slu7'
ID617543
Institutional Source Beutler Lab
Gene Symbol Slu7
Ensembl Gene ENSMUSG00000020409
Gene NameSLU7 splicing factor homolog (S. cerevisiae)
SynonymsD3Bwg0878e, D11Ertd730e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8023 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location43433744-43447981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 43446148 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 572 (R572Q)
Ref Sequence ENSEMBL: ENSMUSP00000020681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020681] [ENSMUST00000151880] [ENSMUST00000178622]
Predicted Effect probably benign
Transcript: ENSMUST00000020681
AA Change: R572Q

PolyPhen 2 Score 0.234 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020681
Gene: ENSMUSG00000020409
AA Change: R572Q

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
ZnF_C2HC 119 135 4.08e-1 SMART
Pfam:Slu7 160 434 1.3e-90 PFAM
coiled coil region 484 543 N/A INTRINSIC
low complexity region 555 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151880
SMART Domains Protein: ENSMUSP00000116609
Gene: ENSMUSG00000020409

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
ZnF_C2HC 119 135 4.08e-1 SMART
Pfam:Slu7 160 434 2.4e-91 PFAM
low complexity region 486 497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178622
AA Change: R572Q

PolyPhen 2 Score 0.234 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000137281
Gene: ENSMUSG00000020409
AA Change: R572Q

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
ZnF_C2HC 119 135 4.08e-1 SMART
Pfam:Slu7 161 434 1.6e-112 PFAM
coiled coil region 484 543 N/A INTRINSIC
low complexity region 555 570 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Pre-mRNA splicing occurs in two sequential transesterification steps. The protein encoded by this gene is a splicing factor that has been found to be essential during the second catalytic step in the pre-mRNA splicing process. It associates with the spliceosome and contains a zinc knuckle motif that is found in other splicing factors and is involved in protein-nucleic acid and protein-protein interactions. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 A G 17: 56,845,448 Y665H probably damaging Het
Agbl4 T A 4: 111,617,148 V378E probably benign Het
Card9 T C 2: 26,357,315 D274G probably benign Het
Ccnc T C 4: 21,747,578 probably null Het
Col1a2 T G 6: 4,533,847 S843A unknown Het
Cux1 T A 5: 136,373,397 I111F probably damaging Het
Fam24b A C 7: 131,326,140 S107A probably benign Het
Fndc7 C T 3: 108,867,145 C599Y probably damaging Het
Gm3604 G A 13: 62,369,869 A225V probably damaging Het
Gm498 T C 7: 143,891,791 S192P probably damaging Het
Grhl3 A G 4: 135,550,329 V475A probably benign Het
Heg1 T A 16: 33,730,525 V958E possibly damaging Het
Hibch T C 1: 52,860,038 M30T probably benign Het
Hist2h2ac A G 3: 96,220,790 S19P unknown Het
Hk2 T A 6: 82,728,809 M838L probably benign Het
Hpd A G 5: 123,176,234 F206S probably damaging Het
Il34 C T 8: 110,742,652 C177Y probably damaging Het
Il6ra A G 3: 89,912,953 probably null Het
Itpr2 A G 6: 146,187,490 I2240T probably damaging Het
Med24 A G 11: 98,718,495 probably null Het
Mpz A G 1: 171,160,033 D246G probably damaging Het
Ncam1 C A 9: 49,509,757 A753S probably benign Het
Ndufs2 A T 1: 171,236,694 M375K probably damaging Het
Obox2 A G 7: 15,397,220 K84E possibly damaging Het
Olfr1183 A G 2: 88,461,678 I132V probably benign Het
Olfr18 C T 9: 20,314,249 V224I probably benign Het
Olfr639 A G 7: 104,011,799 I301T probably damaging Het
Pds5a A T 5: 65,637,898 L665Q probably damaging Het
Prr29 A G 11: 106,376,273 E38G probably benign Het
Ptpn3 G C 4: 57,248,688 D215E probably benign Het
Ptprq G A 10: 107,652,616 Q987* probably null Het
Ranbp6 T C 19: 29,811,822 S377G possibly damaging Het
Rps6ka1 A T 4: 133,867,195 L168Q probably damaging Het
Sall1 A G 8: 89,032,543 I311T probably damaging Het
Satb2 T C 1: 56,891,231 Y211C probably damaging Het
Sis T A 3: 72,952,480 Y314F probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc6a20a T C 9: 123,660,592 N129D probably damaging Het
Tbx6 C T 7: 126,782,859 A123V possibly damaging Het
Tcn2 A T 11: 3,927,579 I23K possibly damaging Het
Tiparp A G 3: 65,531,803 D180G probably benign Het
Tln2 A G 9: 67,224,064 L1400P probably damaging Het
Ttf2 T C 3: 100,956,255 T588A probably benign Het
Ttn A G 2: 76,939,220 V2741A unknown Het
Txlna A T 4: 129,639,485 S83R probably damaging Het
Vmn2r16 C T 5: 109,340,406 Q382* probably null Het
Vmn2r76 A G 7: 86,229,820 V424A probably benign Het
Zfc3h1 T A 10: 115,420,648 L1508I probably damaging Het
Zfp189 G A 4: 49,530,312 G472R probably damaging Het
Zfp462 G A 4: 55,073,106 probably null Het
Other mutations in Slu7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01886:Slu7 APN 11 43439260 missense probably damaging 1.00
IGL02212:Slu7 APN 11 43440642 missense probably benign 0.05
IGL02657:Slu7 APN 11 43442022 splice site probably null
IGL02671:Slu7 APN 11 43445475 splice site probably null
IGL02702:Slu7 APN 11 43438892 splice site probably benign
IGL02720:Slu7 APN 11 43445203 missense probably benign 0.00
IGL02831:Slu7 APN 11 43442653 nonsense probably null
IGL03104:Slu7 APN 11 43442056 missense probably benign 0.36
IGL03106:Slu7 APN 11 43442630 missense possibly damaging 0.46
R0571:Slu7 UTSW 11 43441578 critical splice donor site probably null
R1498:Slu7 UTSW 11 43438217 missense possibly damaging 0.78
R1753:Slu7 UTSW 11 43439268 missense probably benign 0.40
R1789:Slu7 UTSW 11 43445242 missense probably benign 0.00
R2655:Slu7 UTSW 11 43440648 missense probably benign 0.03
R2941:Slu7 UTSW 11 43444757 missense probably benign 0.06
R3916:Slu7 UTSW 11 43440684 splice site probably null
R3917:Slu7 UTSW 11 43440684 splice site probably null
R4084:Slu7 UTSW 11 43443391 missense probably benign 0.03
R4393:Slu7 UTSW 11 43439269 missense possibly damaging 0.89
R5656:Slu7 UTSW 11 43443418 missense probably benign 0.03
R5884:Slu7 UTSW 11 43443418 missense probably benign 0.03
R6320:Slu7 UTSW 11 43441489 missense probably benign 0.22
R6517:Slu7 UTSW 11 43438148 missense probably damaging 1.00
R7763:Slu7 UTSW 11 43444765 missense probably damaging 1.00
R7893:Slu7 UTSW 11 43444836 splice site probably null
R8251:Slu7 UTSW 11 43439301 missense probably damaging 1.00
R8481:Slu7 UTSW 11 43437493 missense probably damaging 0.99
R8481:Slu7 UTSW 11 43437494 missense probably damaging 0.98
R8733:Slu7 UTSW 11 43443340 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGCTGACTCCATTCTTTC -3'
(R):5'- GTTGAGAAGACTTTGAGACTTCAG -3'

Sequencing Primer
(F):5'- GATAGAACACTCTATTCCATGGGGC -3'
(R):5'- GCTGGAAAGAACATGCTG -3'
Posted On2020-01-23