Incidental Mutation 'R8023:Slu7'
ID617543
Institutional Source Beutler Lab
Gene Symbol Slu7
Ensembl Gene ENSMUSG00000020409
Gene NameSLU7 splicing factor homolog (S. cerevisiae)
SynonymsD3Bwg0878e, D11Ertd730e
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8023 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location43433744-43447981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 43446148 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 572 (R572Q)
Ref Sequence ENSEMBL: ENSMUSP00000020681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020681] [ENSMUST00000151880] [ENSMUST00000178622]
Predicted Effect probably benign
Transcript: ENSMUST00000020681
AA Change: R572Q

PolyPhen 2 Score 0.234 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020681
Gene: ENSMUSG00000020409
AA Change: R572Q

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
ZnF_C2HC 119 135 4.08e-1 SMART
Pfam:Slu7 160 434 1.3e-90 PFAM
coiled coil region 484 543 N/A INTRINSIC
low complexity region 555 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151880
SMART Domains Protein: ENSMUSP00000116609
Gene: ENSMUSG00000020409

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
ZnF_C2HC 119 135 4.08e-1 SMART
Pfam:Slu7 160 434 2.4e-91 PFAM
low complexity region 486 497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178622
AA Change: R572Q

PolyPhen 2 Score 0.234 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000137281
Gene: ENSMUSG00000020409
AA Change: R572Q

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
ZnF_C2HC 119 135 4.08e-1 SMART
Pfam:Slu7 161 434 1.6e-112 PFAM
coiled coil region 484 543 N/A INTRINSIC
low complexity region 555 570 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Pre-mRNA splicing occurs in two sequential transesterification steps. The protein encoded by this gene is a splicing factor that has been found to be essential during the second catalytic step in the pre-mRNA splicing process. It associates with the spliceosome and contains a zinc knuckle motif that is found in other splicing factors and is involved in protein-nucleic acid and protein-protein interactions. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 A G 17: 56,845,448 Y665H probably damaging Het
Agbl4 T A 4: 111,617,148 V378E probably benign Het
Card9 T C 2: 26,357,315 D274G probably benign Het
Ccnc T C 4: 21,747,578 probably null Het
Col1a2 T G 6: 4,533,847 S843A unknown Het
Cux1 T A 5: 136,373,397 I111F probably damaging Het
Fam24b A C 7: 131,326,140 S107A probably benign Het
Fndc7 C T 3: 108,867,145 C599Y probably damaging Het
Gm3604 G A 13: 62,369,869 A225V probably damaging Het
Gm498 T C 7: 143,891,791 S192P probably damaging Het
Grhl3 A G 4: 135,550,329 V475A probably benign Het
Heg1 T A 16: 33,730,525 V958E possibly damaging Het
Hibch T C 1: 52,860,038 M30T probably benign Het
Hist2h2ac A G 3: 96,220,790 S19P unknown Het
Hk2 T A 6: 82,728,809 M838L probably benign Het
Hpd A G 5: 123,176,234 F206S probably damaging Het
Il34 C T 8: 110,742,652 C177Y probably damaging Het
Il6ra A G 3: 89,912,953 probably null Het
Itpr2 A G 6: 146,187,490 I2240T probably damaging Het
Med24 A G 11: 98,718,495 probably null Het
Mpz A G 1: 171,160,033 D246G probably damaging Het
Ncam1 C A 9: 49,509,757 A753S probably benign Het
Ndufs2 A T 1: 171,236,694 M375K probably damaging Het
Obox2 A G 7: 15,397,220 K84E possibly damaging Het
Olfr1183 A G 2: 88,461,678 I132V probably benign Het
Olfr18 C T 9: 20,314,249 V224I probably benign Het
Olfr639 A G 7: 104,011,799 I301T probably damaging Het
Pds5a A T 5: 65,637,898 L665Q probably damaging Het
Prr29 A G 11: 106,376,273 E38G probably benign Het
Ptpn3 G C 4: 57,248,688 D215E probably benign Het
Ptprq G A 10: 107,652,616 Q987* probably null Het
Ranbp6 T C 19: 29,811,822 S377G possibly damaging Het
Rps6ka1 A T 4: 133,867,195 L168Q probably damaging Het
Sall1 A G 8: 89,032,543 I311T probably damaging Het
Satb2 T C 1: 56,891,231 Y211C probably damaging Het
Sis T A 3: 72,952,480 Y314F probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc6a20a T C 9: 123,660,592 N129D probably damaging Het
Tbx6 C T 7: 126,782,859 A123V possibly damaging Het
Tcn2 A T 11: 3,927,579 I23K possibly damaging Het
Tiparp A G 3: 65,531,803 D180G probably benign Het
Tln2 A G 9: 67,224,064 L1400P probably damaging Het
Ttf2 T C 3: 100,956,255 T588A probably benign Het
Ttn A G 2: 76,939,220 V2741A unknown Het
Txlna A T 4: 129,639,485 S83R probably damaging Het
Vmn2r16 C T 5: 109,340,406 Q382* probably null Het
Vmn2r76 A G 7: 86,229,820 V424A probably benign Het
Zfc3h1 T A 10: 115,420,648 L1508I probably damaging Het
Zfp189 G A 4: 49,530,312 G472R probably damaging Het
Zfp462 G A 4: 55,073,106 probably null Het
Other mutations in Slu7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01886:Slu7 APN 11 43439260 missense probably damaging 1.00
IGL02212:Slu7 APN 11 43440642 missense probably benign 0.05
IGL02657:Slu7 APN 11 43442022 splice site probably null
IGL02671:Slu7 APN 11 43445475 splice site probably null
IGL02702:Slu7 APN 11 43438892 splice site probably benign
IGL02720:Slu7 APN 11 43445203 missense probably benign 0.00
IGL02831:Slu7 APN 11 43442653 nonsense probably null
IGL03104:Slu7 APN 11 43442056 missense probably benign 0.36
IGL03106:Slu7 APN 11 43442630 missense possibly damaging 0.46
R0571:Slu7 UTSW 11 43441578 critical splice donor site probably null
R1498:Slu7 UTSW 11 43438217 missense possibly damaging 0.78
R1753:Slu7 UTSW 11 43439268 missense probably benign 0.40
R1789:Slu7 UTSW 11 43445242 missense probably benign 0.00
R2655:Slu7 UTSW 11 43440648 missense probably benign 0.03
R2941:Slu7 UTSW 11 43444757 missense probably benign 0.06
R3916:Slu7 UTSW 11 43440684 splice site probably null
R3917:Slu7 UTSW 11 43440684 splice site probably null
R4084:Slu7 UTSW 11 43443391 missense probably benign 0.03
R4393:Slu7 UTSW 11 43439269 missense possibly damaging 0.89
R5656:Slu7 UTSW 11 43443418 missense probably benign 0.03
R5884:Slu7 UTSW 11 43443418 missense probably benign 0.03
R6320:Slu7 UTSW 11 43441489 missense probably benign 0.22
R6517:Slu7 UTSW 11 43438148 missense probably damaging 1.00
R7763:Slu7 UTSW 11 43444765 missense probably damaging 1.00
R7893:Slu7 UTSW 11 43444836 splice site probably null
R7976:Slu7 UTSW 11 43444836 splice site probably null
Predicted Primers PCR Primer
(F):5'- GGGGCTGACTCCATTCTTTC -3'
(R):5'- GTTGAGAAGACTTTGAGACTTCAG -3'

Sequencing Primer
(F):5'- GATAGAACACTCTATTCCATGGGGC -3'
(R):5'- GCTGGAAAGAACATGCTG -3'
Posted On2020-01-23