Incidental Mutation 'R8023:Heg1'
ID617547
Institutional Source Beutler Lab
Gene Symbol Heg1
Ensembl Gene ENSMUSG00000075254
Gene Nameheart development protein with EGF-like domains 1
Synonyms5530401I02Rik, 9530025L16Rik, LOC268884, 4632417D23Rik
Accession Numbers

Genbank: NM_175256.5

Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R8023 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location33684370-33771576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33730525 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 958 (V958E)
Ref Sequence ENSEMBL: ENSMUSP00000119790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126532] [ENSMUST00000152782] [ENSMUST00000232568]
Predicted Effect possibly damaging
Transcript: ENSMUST00000126532
AA Change: V958E

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119790
Gene: ENSMUSG00000075254
AA Change: V958E

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 53 66 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
low complexity region 175 190 N/A INTRINSIC
low complexity region 265 282 N/A INTRINSIC
low complexity region 471 480 N/A INTRINSIC
low complexity region 486 502 N/A INTRINSIC
low complexity region 556 575 N/A INTRINSIC
low complexity region 637 682 N/A INTRINSIC
low complexity region 868 888 N/A INTRINSIC
EGF 944 979 4e-5 SMART
EGF_CA 981 1019 1.01e-10 SMART
EGF_like 1139 1187 6.81e1 SMART
transmembrane domain 1204 1226 N/A INTRINSIC
PDB:4HDQ|C 1312 1337 2e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000152782
AA Change: V703E

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123686
Gene: ENSMUSG00000075254
AA Change: V703E

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 53 66 N/A INTRINSIC
low complexity region 68 104 N/A INTRINSIC
low complexity region 170 183 N/A INTRINSIC
low complexity region 185 202 N/A INTRINSIC
low complexity region 301 320 N/A INTRINSIC
low complexity region 382 427 N/A INTRINSIC
low complexity region 613 633 N/A INTRINSIC
EGF 689 724 4e-5 SMART
EGF_CA 726 764 1.01e-10 SMART
EGF_like 884 932 6.81e1 SMART
transmembrane domain 949 971 N/A INTRINSIC
PDB:4HDQ|C 1057 1082 1e-10 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000232568
AA Change: V934E

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired integrity of the heart, blood vessels and lymphatic vessels, resulting in hemopericardium, lung hemorrhage, lymphangiectasis, and chylous ascites, as well as embryonic and postnatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(3) Gene trapped(3)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 A G 17: 56,845,448 Y665H probably damaging Het
Agbl4 T A 4: 111,617,148 V378E probably benign Het
Card9 T C 2: 26,357,315 D274G probably benign Het
Ccnc T C 4: 21,747,578 probably null Het
Col1a2 T G 6: 4,533,847 S843A unknown Het
Cux1 T A 5: 136,373,397 I111F probably damaging Het
Fam24b A C 7: 131,326,140 S107A probably benign Het
Fndc7 C T 3: 108,867,145 C599Y probably damaging Het
Gm3604 G A 13: 62,369,869 A225V probably damaging Het
Gm498 T C 7: 143,891,791 S192P probably damaging Het
Grhl3 A G 4: 135,550,329 V475A probably benign Het
Hibch T C 1: 52,860,038 M30T probably benign Het
Hist2h2ac A G 3: 96,220,790 S19P unknown Het
Hk2 T A 6: 82,728,809 M838L probably benign Het
Hpd A G 5: 123,176,234 F206S probably damaging Het
Il34 C T 8: 110,742,652 C177Y probably damaging Het
Il6ra A G 3: 89,912,953 probably null Het
Itpr2 A G 6: 146,187,490 I2240T probably damaging Het
Med24 A G 11: 98,718,495 probably null Het
Mpz A G 1: 171,160,033 D246G probably damaging Het
Ncam1 C A 9: 49,509,757 A753S probably benign Het
Ndufs2 A T 1: 171,236,694 M375K probably damaging Het
Obox2 A G 7: 15,397,220 K84E possibly damaging Het
Olfr1183 A G 2: 88,461,678 I132V probably benign Het
Olfr18 C T 9: 20,314,249 V224I probably benign Het
Olfr639 A G 7: 104,011,799 I301T probably damaging Het
Pds5a A T 5: 65,637,898 L665Q probably damaging Het
Prr29 A G 11: 106,376,273 E38G probably benign Het
Ptpn3 G C 4: 57,248,688 D215E probably benign Het
Ptprq G A 10: 107,652,616 Q987* probably null Het
Ranbp6 T C 19: 29,811,822 S377G possibly damaging Het
Rps6ka1 A T 4: 133,867,195 L168Q probably damaging Het
Sall1 A G 8: 89,032,543 I311T probably damaging Het
Satb2 T C 1: 56,891,231 Y211C probably damaging Het
Sis T A 3: 72,952,480 Y314F probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc6a20a T C 9: 123,660,592 N129D probably damaging Het
Slu7 G A 11: 43,446,148 R572Q probably benign Het
Tbx6 C T 7: 126,782,859 A123V possibly damaging Het
Tcn2 A T 11: 3,927,579 I23K possibly damaging Het
Tiparp A G 3: 65,531,803 D180G probably benign Het
Tln2 A G 9: 67,224,064 L1400P probably damaging Het
Ttf2 T C 3: 100,956,255 T588A probably benign Het
Ttn A G 2: 76,939,220 V2741A unknown Het
Txlna A T 4: 129,639,485 S83R probably damaging Het
Vmn2r16 C T 5: 109,340,406 Q382* probably null Het
Vmn2r76 A G 7: 86,229,820 V424A probably benign Het
Zfc3h1 T A 10: 115,420,648 L1508I probably damaging Het
Zfp189 G A 4: 49,530,312 G472R probably damaging Het
Zfp462 G A 4: 55,073,106 probably null Het
Other mutations in Heg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Heg1 APN 16 33710607 missense probably damaging 0.98
IGL01133:Heg1 APN 16 33727287 missense probably benign 0.01
IGL01410:Heg1 APN 16 33725566 missense possibly damaging 0.95
IGL01561:Heg1 APN 16 33766668 missense probably benign 0.27
IGL02449:Heg1 APN 16 33738725 critical splice donor site probably null
IGL02523:Heg1 APN 16 33738622 missense probably damaging 1.00
IGL02794:Heg1 APN 16 33726622 missense probably damaging 0.99
IGL03240:Heg1 APN 16 33727413 missense probably benign 0.02
I2289:Heg1 UTSW 16 33763459 missense probably damaging 1.00
R0089:Heg1 UTSW 16 33763615 missense probably damaging 1.00
R0116:Heg1 UTSW 16 33735658 splice site probably benign
R0514:Heg1 UTSW 16 33726756 missense possibly damaging 0.86
R0589:Heg1 UTSW 16 33731707 missense probably damaging 1.00
R0942:Heg1 UTSW 16 33760803 missense probably damaging 1.00
R1084:Heg1 UTSW 16 33706997 missense probably benign 0.26
R1109:Heg1 UTSW 16 33763591 missense probably damaging 1.00
R1375:Heg1 UTSW 16 33726876 missense possibly damaging 0.75
R1375:Heg1 UTSW 16 33727309 missense possibly damaging 0.60
R1550:Heg1 UTSW 16 33735553 missense probably damaging 1.00
R1720:Heg1 UTSW 16 33707179 missense probably benign 0.44
R1739:Heg1 UTSW 16 33738583 missense possibly damaging 0.94
R2068:Heg1 UTSW 16 33727590 missense probably benign 0.14
R2397:Heg1 UTSW 16 33742479 missense probably damaging 0.99
R4353:Heg1 UTSW 16 33710477 missense probably benign 0.41
R4419:Heg1 UTSW 16 33727435 missense probably benign 0.23
R4420:Heg1 UTSW 16 33727435 missense probably benign 0.23
R4779:Heg1 UTSW 16 33719772 missense probably benign 0.41
R5066:Heg1 UTSW 16 33738671 missense probably benign 0.41
R5227:Heg1 UTSW 16 33763591 missense probably damaging 1.00
R5494:Heg1 UTSW 16 33725434 missense probably benign 0.44
R5645:Heg1 UTSW 16 33706963 missense probably benign
R5708:Heg1 UTSW 16 33742404 missense probably damaging 0.99
R5934:Heg1 UTSW 16 33726919 missense probably damaging 1.00
R6074:Heg1 UTSW 16 33727203 missense possibly damaging 0.49
R6374:Heg1 UTSW 16 33727129 missense possibly damaging 0.86
R6398:Heg1 UTSW 16 33766775 missense probably damaging 0.99
R6774:Heg1 UTSW 16 33738268 missense probably damaging 1.00
R6843:Heg1 UTSW 16 33719526 missense probably benign 0.41
R7091:Heg1 UTSW 16 33726720 missense probably benign 0.01
R7183:Heg1 UTSW 16 33738550 splice site probably null
R7186:Heg1 UTSW 16 33731664 missense probably damaging 1.00
R7294:Heg1 UTSW 16 33726489 missense probably damaging 0.99
R7304:Heg1 UTSW 16 33760790 missense possibly damaging 0.52
R7405:Heg1 UTSW 16 33763449 missense possibly damaging 0.66
R7614:Heg1 UTSW 16 33727363 missense probably benign
R7638:Heg1 UTSW 16 33727497 missense probably damaging 1.00
R7880:Heg1 UTSW 16 33719509 missense possibly damaging 0.93
R7963:Heg1 UTSW 16 33719509 missense possibly damaging 0.93
X0066:Heg1 UTSW 16 33727416 missense probably benign 0.16
Z1177:Heg1 UTSW 16 33720687 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCCTGCTCTATCTTAGTGGG -3'
(R):5'- CCTTTGTACACTCTAGAACAAACAG -3'

Sequencing Primer
(F):5'- CTCTATCTTAGTGGGTGCGAG -3'
(R):5'- GTACTCAAACTTAGGTCCTCTGCAAG -3'
Posted On2020-01-23