Incidental Mutation 'R0680:9230019H11Rik'
ID61755
Institutional Source Beutler Lab
Gene Symbol 9230019H11Rik
Ensembl Gene ENSMUSG00000071434
Gene NameRIKEN cDNA 9230019H11 gene
Synonyms
MMRRC Submission 038865-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock #R0680 (G1)
Quality Score116
Status Not validated
Chromosome10
Chromosomal Location3119841-3129546 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to A at 3125133 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000095874
SMART Domains Protein: ENSMUSP00000093559
Gene: ENSMUSG00000071434

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
PDB:1KCG|C 57 207 2e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217333
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 T C 4: 59,043,967 D1449G probably benign Het
Clca4a A T 3: 144,969,367 F167L probably damaging Het
Col6a3 T C 1: 90,778,981 M2137V unknown Het
Dennd2a A T 6: 39,483,062 L703Q probably damaging Het
Fsip2 T A 2: 82,991,359 I5812N possibly damaging Het
Gen1 T A 12: 11,241,869 S640C probably benign Het
Il9 T C 13: 56,481,880 T61A probably benign Het
Lrp1 A G 10: 127,589,661 L700P probably damaging Het
Lyst G A 13: 13,650,341 V1514I probably benign Het
Med1 A T 11: 98,180,166 probably null Het
Olfr1205 A T 2: 88,831,780 Y221F probably benign Het
Olfr298 A T 7: 86,489,337 F71L probably benign Het
Olfr666 A G 7: 104,893,004 I208T probably benign Het
Olfr810 T A 10: 129,790,818 Y257F probably damaging Het
Pcdhb18 G C 18: 37,490,294 A226P probably damaging Het
Pirb T A 7: 3,717,361 N338Y possibly damaging Het
Rc3h2 A C 2: 37,399,835 I360R probably damaging Het
Rnf139 T C 15: 58,899,652 Y509H probably damaging Het
Shisa7 T A 7: 4,831,723 D279V probably benign Het
Slc6a3 T C 13: 73,538,727 L71P probably damaging Het
Slc9a5 T A 8: 105,355,907 L268Q probably null Het
St7 T C 6: 17,942,733 S563P probably damaging Het
Stx1b A G 7: 127,807,723 V240A possibly damaging Het
Sugt1 A G 14: 79,610,311 I200M possibly damaging Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Ube4a T A 9: 44,948,060 Q380L probably damaging Het
Ugt1a2 A G 1: 88,201,211 Y192C probably damaging Het
Unc93b1 G A 19: 3,947,093 V505I probably benign Het
Usp29 T C 7: 6,962,885 S576P possibly damaging Het
Vcan A T 13: 89,679,822 H2208Q probably damaging Het
Zcchc6 G A 13: 59,800,599 T636I possibly damaging Het
Zfp106 T A 2: 120,527,016 S1133C probably damaging Het
Zfp148 A G 16: 33,495,804 D282G possibly damaging Het
Zswim9 A C 7: 13,260,321 V636G probably benign Het
Other mutations in 9230019H11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:9230019H11Rik APN 10 3120231 unclassified noncoding transcript
IGL01018:9230019H11Rik APN 10 3120209 unclassified noncoding transcript
IGL01018:9230019H11Rik APN 10 3125031 unclassified noncoding transcript
IGL01018:9230019H11Rik APN 10 3125193 exon noncoding transcript
IGL02388:9230019H11Rik APN 10 3125050 unclassified noncoding transcript
IGL02560:9230019H11Rik APN 10 3125866 exon noncoding transcript
IGL03293:9230019H11Rik APN 10 3125699 exon noncoding transcript
R0357:9230019H11Rik UTSW 10 3120307 unclassified noncoding transcript
R0357:9230019H11Rik UTSW 10 3125788 exon noncoding transcript
R0582:9230019H11Rik UTSW 10 3125082 unclassified noncoding transcript
R1116:9230019H11Rik UTSW 10 3120180 unclassified noncoding transcript
R1519:9230019H11Rik UTSW 10 3125230 exon noncoding transcript
R1717:9230019H11Rik UTSW 10 3125050 unclassified noncoding transcript
R2112:9230019H11Rik UTSW 10 3126459 exon noncoding transcript
R5410:9230019H11Rik UTSW 10 3126473 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- CCCACTGCATGTTTCTTCCACAGAG -3'
(R):5'- TGAATCGTTCATCTGCATACCAGCC -3'

Sequencing Primer
(F):5'- ACAGAGTCTCCTACTCTCTGCTG -3'
(R):5'- tgtagcagtgaggatggaac -3'
Posted On2013-07-30