Incidental Mutation 'R8024:Adhfe1'
ID617550
Institutional Source Beutler Lab
Gene Symbol Adhfe1
Ensembl Gene ENSMUSG00000025911
Gene Namealcohol dehydrogenase, iron containing, 1
Synonyms6330565B14Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R8024 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location9547948-9580673 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 9563855 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 373 (M373K)
Ref Sequence ENSEMBL: ENSMUSP00000116627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027044] [ENSMUST00000144177]
Predicted Effect probably benign
Transcript: ENSMUST00000027044
Predicted Effect probably benign
Transcript: ENSMUST00000144177
AA Change: M373K

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000116627
Gene: ENSMUSG00000025911
AA Change: M373K

DomainStartEndE-ValueType
Pfam:Fe-ADH 50 454 2.1e-105 PFAM
Pfam:Fe-ADH_2 53 155 6.5e-13 PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The ADHFE1 gene encodes hydroxyacid-oxoacid transhydrogenase (EC 1.1.99.24), which is responsible for the oxidation of 4-hydroxybutyrate in mammalian tissues (Kardon et al., 2006 [PubMed 16616524]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,612,594 N1257Y probably benign Het
2310057J18Rik A T 10: 28,982,595 Y133* probably null Het
2310057J18Rik A C 10: 28,986,217 S26A possibly damaging Het
4931409K22Rik A G 5: 24,550,636 M296T possibly damaging Het
9930012K11Rik G T 14: 70,156,667 P220T probably damaging Het
A430105I19Rik A G 2: 118,760,524 probably null Het
Adam1b A C 5: 121,500,923 S686R probably benign Het
Adam8 T C 7: 139,987,576 D418G probably damaging Het
Adcy8 A G 15: 64,920,246 L287P probably damaging Het
Alpk2 T C 18: 65,305,035 S1096G probably benign Het
Ankmy1 A G 1: 92,884,994 V531A probably benign Het
Ano3 C T 2: 110,667,783 E738K probably damaging Het
Ano4 T A 10: 88,971,332 I796F probably damaging Het
Apeh T C 9: 108,092,591 E190G probably benign Het
Cadm3 A G 1: 173,338,055 L346P probably damaging Het
Clec2e G A 6: 129,094,425 H150Y possibly damaging Het
Cnga4 A T 7: 105,406,835 N318Y probably damaging Het
Cnr2 T A 4: 135,916,885 F91L probably damaging Het
Diaph3 T A 14: 86,656,399 E1147V probably damaging Het
Elmo2 T C 2: 165,291,855 T738A unknown Het
Exoc4 T A 6: 33,347,931 W387R probably damaging Het
Fam173b T C 15: 31,608,171 Y123H probably damaging Het
Focad T C 4: 88,397,000 V1379A unknown Het
Frmd4a T C 2: 4,603,702 S794P probably damaging Het
Ftl1-ps1 A G 13: 74,407,051 T150A probably benign Het
Gm5773 C T 3: 93,773,168 A49V probably benign Het
Helz T A 11: 107,686,421 L1867Q unknown Het
Il22ra1 A G 4: 135,734,278 H118R probably benign Het
Inf2 C T 12: 112,608,902 P856S unknown Het
Ints5 T A 19: 8,896,140 L488I probably damaging Het
Kifc1 G A 17: 33,883,203 R479C probably damaging Het
Lrba T A 3: 86,295,401 C289* probably null Het
Mael A G 1: 166,226,627 L196S probably damaging Het
Med23 T A 10: 24,879,683 S229R possibly damaging Het
Mroh9 T C 1: 163,039,233 N645D probably benign Het
Myom3 G A 4: 135,801,748 V1132I probably benign Het
Ndufa13 A T 8: 69,894,537 L71H probably damaging Het
Nepro A T 16: 44,731,415 H212L probably benign Het
Nox4 T A 7: 87,304,910 L141Q probably damaging Het
Olfr1254 T C 2: 89,789,046 E102G probably benign Het
Olfr283 T A 15: 98,378,997 M38L probably benign Het
Olfr473 T C 7: 107,934,438 V306A probably benign Het
Olfr482 T A 7: 108,095,289 T94S probably benign Het
Olfr811 T G 10: 129,801,943 E194A probably damaging Het
Pfpl A G 19: 12,430,206 D607G possibly damaging Het
Pkd1l2 A T 8: 117,076,182 F233L possibly damaging Het
Ptprz1 A T 6: 23,042,751 E2058V probably damaging Het
Rag1 A T 2: 101,642,507 N763K probably damaging Het
Rhbg A C 3: 88,248,453 D63E probably damaging Het
Rrm1 T A 7: 102,457,265 F330L probably benign Het
Scaf8 A T 17: 3,159,293 Q97L unknown Het
Sdr9c7 G A 10: 127,898,882 V80I probably benign Het
Slc18a1 A G 8: 69,075,147 V4A probably benign Het
Slirp T C 12: 87,447,600 V45A probably damaging Het
Spata31 A T 13: 64,922,804 Q922L probably benign Het
Spg11 A G 2: 122,097,321 S661P possibly damaging Het
Stab2 G T 10: 86,846,052 T2495K probably benign Het
Supt16 A G 14: 52,170,875 I871T probably damaging Het
Sval2 A G 6: 41,860,364 Q9R probably damaging Het
Syngap1 A T 17: 26,941,452 M1L probably benign Het
Tfpi A T 2: 84,453,922 M62K possibly damaging Het
Tm4sf1 A T 3: 57,287,765 Y200* probably null Het
Tmc1 A T 19: 20,900,817 W105R probably damaging Het
Tmtc2 T C 10: 105,190,126 E827G probably benign Het
Tollip T C 7: 141,892,826 I33V probably benign Het
Unc80 T A 1: 66,606,644 V1493D possibly damaging Het
Vmn2r6 G A 3: 64,559,824 R85W probably benign Het
Vwa5a C A 9: 38,736,020 S565* probably null Het
Xbp1 T A 11: 5,521,910 V12D probably benign Het
Other mutations in Adhfe1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01353:Adhfe1 APN 1 9566863 missense probably benign
IGL01735:Adhfe1 APN 1 9548148 missense possibly damaging 0.90
IGL02862:Adhfe1 APN 1 9553811 missense probably damaging 1.00
IGL02891:Adhfe1 APN 1 9558171 missense probably benign
IGL03198:Adhfe1 APN 1 9549952 splice site probably benign
IGL03297:Adhfe1 APN 1 9549948 splice site probably benign
R0095:Adhfe1 UTSW 1 9560177 missense possibly damaging 0.79
R0180:Adhfe1 UTSW 1 9563857 missense probably benign 0.00
R0347:Adhfe1 UTSW 1 9553430 missense probably benign 0.00
R0590:Adhfe1 UTSW 1 9548153 critical splice donor site probably null
R1509:Adhfe1 UTSW 1 9553446 missense probably benign 0.03
R1606:Adhfe1 UTSW 1 9553473 critical splice donor site probably null
R1720:Adhfe1 UTSW 1 9566900 missense probably benign 0.01
R2048:Adhfe1 UTSW 1 9563553 missense probably benign 0.00
R3918:Adhfe1 UTSW 1 9576216 missense probably damaging 0.99
R4375:Adhfe1 UTSW 1 9561628 intron probably benign
R4576:Adhfe1 UTSW 1 9553754 missense probably damaging 1.00
R4653:Adhfe1 UTSW 1 9550578 intron probably benign
R4724:Adhfe1 UTSW 1 9576250 missense probably damaging 0.99
R4760:Adhfe1 UTSW 1 9563523 missense probably damaging 0.97
R4859:Adhfe1 UTSW 1 9558213 missense probably damaging 1.00
R4967:Adhfe1 UTSW 1 9566804 missense probably benign 0.11
R4970:Adhfe1 UTSW 1 9558238 missense possibly damaging 0.92
R5087:Adhfe1 UTSW 1 9561626 intron probably benign
R6146:Adhfe1 UTSW 1 9553718 missense probably damaging 0.98
R7013:Adhfe1 UTSW 1 9550591 intron probably benign
R7084:Adhfe1 UTSW 1 9566805 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACCCTGGCAAGAACTCTG -3'
(R):5'- TTCTCAAGAGGCGACATCAGAG -3'

Sequencing Primer
(F):5'- TGGCAAGAACTCTGCCACCAG -3'
(R):5'- AAATGATGGCATGTAAGTGCTGTCC -3'
Posted On2020-01-23