Incidental Mutation 'R8024:Cadm3'
ID617555
Institutional Source Beutler Lab
Gene Symbol Cadm3
Ensembl Gene ENSMUSG00000005338
Gene Namecell adhesion molecule 3
SynonymsSynCAM3, Tsll1, Igsf4b, BIgR, Necl-1, Necl1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R8024 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location173333258-173367695 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 173338055 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 346 (L346P)
Ref Sequence ENSEMBL: ENSMUSP00000106851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005470] [ENSMUST00000038227] [ENSMUST00000111220] [ENSMUST00000194046]
Predicted Effect probably damaging
Transcript: ENSMUST00000005470
AA Change: L380P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000005470
Gene: ENSMUSG00000005338
AA Change: L380P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 67 159 1.43e-8 SMART
IG 169 262 6.31e-1 SMART
IGc2 277 338 3.91e-6 SMART
low complexity region 351 359 N/A INTRINSIC
4.1m 383 401 9.24e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000038227
SMART Domains Protein: ENSMUSP00000045134
Gene: ENSMUSG00000037872

DomainStartEndE-ValueType
SCOP:d1l9ha_ 26 317 1e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111220
AA Change: L346P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106851
Gene: ENSMUSG00000005338
AA Change: L346P

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
IG 33 125 1.43e-8 SMART
IG 135 228 6.31e-1 SMART
IGc2 243 304 3.91e-6 SMART
low complexity region 317 325 N/A INTRINSIC
4.1m 349 367 9.24e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194046
SMART Domains Protein: ENSMUSP00000141765
Gene: ENSMUSG00000037872

DomainStartEndE-ValueType
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a calcium-independent cell-cell adhesion protein that can form homodimers or heterodimers with other nectin proteins. The encoded protein has both homophilic and heterophilic cell-cell adhesion activity. This gene is reported to be a tumor suppressor gene. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit delayed myelination. Other mice with ubiquitous conditional deletion of the gene do not display neurological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,612,594 N1257Y probably benign Het
2310057J18Rik A T 10: 28,982,595 Y133* probably null Het
2310057J18Rik A C 10: 28,986,217 S26A possibly damaging Het
4931409K22Rik A G 5: 24,550,636 M296T possibly damaging Het
9930012K11Rik G T 14: 70,156,667 P220T probably damaging Het
A430105I19Rik A G 2: 118,760,524 probably null Het
Adam1b A C 5: 121,500,923 S686R probably benign Het
Adam8 T C 7: 139,987,576 D418G probably damaging Het
Adcy8 A G 15: 64,920,246 L287P probably damaging Het
Adhfe1 T A 1: 9,563,855 M373K probably benign Het
Alpk2 T C 18: 65,305,035 S1096G probably benign Het
Ankmy1 A G 1: 92,884,994 V531A probably benign Het
Ano3 C T 2: 110,667,783 E738K probably damaging Het
Ano4 T A 10: 88,971,332 I796F probably damaging Het
Apeh T C 9: 108,092,591 E190G probably benign Het
Clec2e G A 6: 129,094,425 H150Y possibly damaging Het
Cnga4 A T 7: 105,406,835 N318Y probably damaging Het
Cnr2 T A 4: 135,916,885 F91L probably damaging Het
Diaph3 T A 14: 86,656,399 E1147V probably damaging Het
Elmo2 T C 2: 165,291,855 T738A unknown Het
Exoc4 T A 6: 33,347,931 W387R probably damaging Het
Fam173b T C 15: 31,608,171 Y123H probably damaging Het
Focad T C 4: 88,397,000 V1379A unknown Het
Frmd4a T C 2: 4,603,702 S794P probably damaging Het
Ftl1-ps1 A G 13: 74,407,051 T150A probably benign Het
Gm5773 C T 3: 93,773,168 A49V probably benign Het
Helz T A 11: 107,686,421 L1867Q unknown Het
Il22ra1 A G 4: 135,734,278 H118R probably benign Het
Inf2 C T 12: 112,608,902 P856S unknown Het
Ints5 T A 19: 8,896,140 L488I probably damaging Het
Kifc1 G A 17: 33,883,203 R479C probably damaging Het
Lrba T A 3: 86,295,401 C289* probably null Het
Mael A G 1: 166,226,627 L196S probably damaging Het
Med23 T A 10: 24,879,683 S229R possibly damaging Het
Mroh9 T C 1: 163,039,233 N645D probably benign Het
Myom3 G A 4: 135,801,748 V1132I probably benign Het
Ndufa13 A T 8: 69,894,537 L71H probably damaging Het
Nepro A T 16: 44,731,415 H212L probably benign Het
Nox4 T A 7: 87,304,910 L141Q probably damaging Het
Olfr1254 T C 2: 89,789,046 E102G probably benign Het
Olfr283 T A 15: 98,378,997 M38L probably benign Het
Olfr473 T C 7: 107,934,438 V306A probably benign Het
Olfr482 T A 7: 108,095,289 T94S probably benign Het
Olfr811 T G 10: 129,801,943 E194A probably damaging Het
Pfpl A G 19: 12,430,206 D607G possibly damaging Het
Pkd1l2 A T 8: 117,076,182 F233L possibly damaging Het
Ptprz1 A T 6: 23,042,751 E2058V probably damaging Het
Rag1 A T 2: 101,642,507 N763K probably damaging Het
Rhbg A C 3: 88,248,453 D63E probably damaging Het
Rrm1 T A 7: 102,457,265 F330L probably benign Het
Scaf8 A T 17: 3,159,293 Q97L unknown Het
Sdr9c7 G A 10: 127,898,882 V80I probably benign Het
Slc18a1 A G 8: 69,075,147 V4A probably benign Het
Slirp T C 12: 87,447,600 V45A probably damaging Het
Spata31 A T 13: 64,922,804 Q922L probably benign Het
Spg11 A G 2: 122,097,321 S661P possibly damaging Het
Stab2 G T 10: 86,846,052 T2495K probably benign Het
Supt16 A G 14: 52,170,875 I871T probably damaging Het
Sval2 A G 6: 41,860,364 Q9R probably damaging Het
Syngap1 A T 17: 26,941,452 M1L probably benign Het
Tfpi A T 2: 84,453,922 M62K possibly damaging Het
Tm4sf1 A T 3: 57,287,765 Y200* probably null Het
Tmc1 A T 19: 20,900,817 W105R probably damaging Het
Tmtc2 T C 10: 105,190,126 E827G probably benign Het
Tollip T C 7: 141,892,826 I33V probably benign Het
Unc80 T A 1: 66,606,644 V1493D possibly damaging Het
Vmn2r6 G A 3: 64,559,824 R85W probably benign Het
Vwa5a C A 9: 38,736,020 S565* probably null Het
Xbp1 T A 11: 5,521,910 V12D probably benign Het
Other mutations in Cadm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01915:Cadm3 APN 1 173341108 missense possibly damaging 0.66
IGL01989:Cadm3 APN 1 173338011 unclassified probably benign
IGL02224:Cadm3 APN 1 173338061 missense possibly damaging 0.51
IGL03105:Cadm3 APN 1 173345016 missense probably damaging 0.96
R0243:Cadm3 UTSW 1 173346573 unclassified probably benign
R0583:Cadm3 UTSW 1 173341171 missense probably benign 0.00
R0689:Cadm3 UTSW 1 173344452 missense possibly damaging 0.95
R2060:Cadm3 UTSW 1 173344402 missense probably damaging 1.00
R2859:Cadm3 UTSW 1 173346545 missense possibly damaging 0.90
R3764:Cadm3 UTSW 1 173346497 missense probably damaging 1.00
R4077:Cadm3 UTSW 1 173341669 missense probably benign 0.01
R4079:Cadm3 UTSW 1 173341669 missense probably benign 0.01
R4521:Cadm3 UTSW 1 173345063 splice site probably null
R4670:Cadm3 UTSW 1 173346446 missense probably damaging 1.00
R4965:Cadm3 UTSW 1 173337097 missense probably damaging 1.00
R5267:Cadm3 UTSW 1 173337102 missense probably damaging 1.00
R6273:Cadm3 UTSW 1 173349124 unclassified probably benign
R6315:Cadm3 UTSW 1 173344352 missense probably benign 0.16
R6342:Cadm3 UTSW 1 173341108 missense possibly damaging 0.66
R6544:Cadm3 UTSW 1 173367411 critical splice donor site probably null
R6565:Cadm3 UTSW 1 173341709 missense possibly damaging 0.81
R7813:Cadm3 UTSW 1 173344389 missense probably benign 0.00
R8078:Cadm3 UTSW 1 173341059 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGATCACAGCACGGGCATTG -3'
(R):5'- CACACAGCAACTGGTTTCTCC -3'

Sequencing Primer
(F):5'- GCATTGCAGGGGTTGGC -3'
(R):5'- ACAGCAACTGGTTTCTCCTGATG -3'
Posted On2020-01-23