Incidental Mutation 'R8024:Olfr1254'
ID617558
Institutional Source Beutler Lab
Gene Symbol Olfr1254
Ensembl Gene ENSMUSG00000075074
Gene Nameolfactory receptor 1254
SynonymsGA_x6K02T2Q125-51230155-51229211, MOR231-13
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R8024 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location89787325-89793619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89789046 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 102 (E102G)
Ref Sequence ENSEMBL: ENSMUSP00000107148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099764] [ENSMUST00000111523] [ENSMUST00000216587]
Predicted Effect probably benign
Transcript: ENSMUST00000099764
AA Change: E102G

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097352
Gene: ENSMUSG00000075074
AA Change: E102G

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 9.7e-30 PFAM
Pfam:7tm_4 137 278 1.3e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111523
AA Change: E102G

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107148
Gene: ENSMUSG00000075074
AA Change: E102G

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.4e-46 PFAM
Pfam:7tm_1 39 285 5.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216587
AA Change: E102G

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,612,594 N1257Y probably benign Het
2310057J18Rik A T 10: 28,982,595 Y133* probably null Het
2310057J18Rik A C 10: 28,986,217 S26A possibly damaging Het
4931409K22Rik A G 5: 24,550,636 M296T possibly damaging Het
9930012K11Rik G T 14: 70,156,667 P220T probably damaging Het
A430105I19Rik A G 2: 118,760,524 probably null Het
Adam1b A C 5: 121,500,923 S686R probably benign Het
Adam8 T C 7: 139,987,576 D418G probably damaging Het
Adcy8 A G 15: 64,920,246 L287P probably damaging Het
Adhfe1 T A 1: 9,563,855 M373K probably benign Het
Alpk2 T C 18: 65,305,035 S1096G probably benign Het
Ankmy1 A G 1: 92,884,994 V531A probably benign Het
Ano3 C T 2: 110,667,783 E738K probably damaging Het
Ano4 T A 10: 88,971,332 I796F probably damaging Het
Apeh T C 9: 108,092,591 E190G probably benign Het
Cadm3 A G 1: 173,338,055 L346P probably damaging Het
Clec2e G A 6: 129,094,425 H150Y possibly damaging Het
Cnga4 A T 7: 105,406,835 N318Y probably damaging Het
Cnr2 T A 4: 135,916,885 F91L probably damaging Het
Diaph3 T A 14: 86,656,399 E1147V probably damaging Het
Elmo2 T C 2: 165,291,855 T738A unknown Het
Exoc4 T A 6: 33,347,931 W387R probably damaging Het
Fam173b T C 15: 31,608,171 Y123H probably damaging Het
Focad T C 4: 88,397,000 V1379A unknown Het
Frmd4a T C 2: 4,603,702 S794P probably damaging Het
Ftl1-ps1 A G 13: 74,407,051 T150A probably benign Het
Gm5773 C T 3: 93,773,168 A49V probably benign Het
Helz T A 11: 107,686,421 L1867Q unknown Het
Il22ra1 A G 4: 135,734,278 H118R probably benign Het
Inf2 C T 12: 112,608,902 P856S unknown Het
Ints5 T A 19: 8,896,140 L488I probably damaging Het
Kifc1 G A 17: 33,883,203 R479C probably damaging Het
Lrba T A 3: 86,295,401 C289* probably null Het
Mael A G 1: 166,226,627 L196S probably damaging Het
Med23 T A 10: 24,879,683 S229R possibly damaging Het
Mroh9 T C 1: 163,039,233 N645D probably benign Het
Myom3 G A 4: 135,801,748 V1132I probably benign Het
Ndufa13 A T 8: 69,894,537 L71H probably damaging Het
Nepro A T 16: 44,731,415 H212L probably benign Het
Nox4 T A 7: 87,304,910 L141Q probably damaging Het
Olfr283 T A 15: 98,378,997 M38L probably benign Het
Olfr473 T C 7: 107,934,438 V306A probably benign Het
Olfr482 T A 7: 108,095,289 T94S probably benign Het
Olfr811 T G 10: 129,801,943 E194A probably damaging Het
Pfpl A G 19: 12,430,206 D607G possibly damaging Het
Pkd1l2 A T 8: 117,076,182 F233L possibly damaging Het
Ptprz1 A T 6: 23,042,751 E2058V probably damaging Het
Rag1 A T 2: 101,642,507 N763K probably damaging Het
Rhbg A C 3: 88,248,453 D63E probably damaging Het
Rrm1 T A 7: 102,457,265 F330L probably benign Het
Scaf8 A T 17: 3,159,293 Q97L unknown Het
Sdr9c7 G A 10: 127,898,882 V80I probably benign Het
Slc18a1 A G 8: 69,075,147 V4A probably benign Het
Slirp T C 12: 87,447,600 V45A probably damaging Het
Spata31 A T 13: 64,922,804 Q922L probably benign Het
Spg11 A G 2: 122,097,321 S661P possibly damaging Het
Stab2 G T 10: 86,846,052 T2495K probably benign Het
Supt16 A G 14: 52,170,875 I871T probably damaging Het
Sval2 A G 6: 41,860,364 Q9R probably damaging Het
Syngap1 A T 17: 26,941,452 M1L probably benign Het
Tfpi A T 2: 84,453,922 M62K possibly damaging Het
Tm4sf1 A T 3: 57,287,765 Y200* probably null Het
Tmc1 A T 19: 20,900,817 W105R probably damaging Het
Tmtc2 T C 10: 105,190,126 E827G probably benign Het
Tollip T C 7: 141,892,826 I33V probably benign Het
Unc80 T A 1: 66,606,644 V1493D possibly damaging Het
Vmn2r6 G A 3: 64,559,824 R85W probably benign Het
Vwa5a C A 9: 38,736,020 S565* probably null Het
Xbp1 T A 11: 5,521,910 V12D probably benign Het
Other mutations in Olfr1254
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Olfr1254 APN 2 89788785 missense probably damaging 1.00
IGL02822:Olfr1254 APN 2 89789100 missense possibly damaging 0.56
R1166:Olfr1254 UTSW 2 89789331 missense possibly damaging 0.74
R1639:Olfr1254 UTSW 2 89789245 missense probably damaging 1.00
R2248:Olfr1254 UTSW 2 89789180 missense possibly damaging 0.59
R2256:Olfr1254 UTSW 2 89788470 missense probably benign
R2351:Olfr1254 UTSW 2 89789178 missense probably damaging 0.97
R4432:Olfr1254 UTSW 2 89788734 missense possibly damaging 0.76
R4649:Olfr1254 UTSW 2 89789293 missense probably benign 0.19
R4788:Olfr1254 UTSW 2 89789136 missense probably damaging 1.00
R6454:Olfr1254 UTSW 2 89789178 missense probably damaging 0.97
R6591:Olfr1254 UTSW 2 89788988 nonsense probably null
R6691:Olfr1254 UTSW 2 89788988 nonsense probably null
R7418:Olfr1254 UTSW 2 89788976 nonsense probably null
R7451:Olfr1254 UTSW 2 89789109 missense probably benign
R8080:Olfr1254 UTSW 2 89788627 missense possibly damaging 0.78
X0022:Olfr1254 UTSW 2 89788731 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCACAGGCAAAATGGTCAATGAC -3'
(R):5'- GTAACAATCATTGCCAGCCC -3'

Sequencing Primer
(F):5'- TGGTCAATGACATTGGGACCAC -3'
(R):5'- ATTGCCAGCCCCTCCTTGAG -3'
Posted On2020-01-23