Incidental Mutation 'R8024:Ano3'
ID617560
Institutional Source Beutler Lab
Gene Symbol Ano3
Ensembl Gene ENSMUSG00000074968
Gene Nameanoctamin 3
SynonymsTmem16c, B230324K02Rik
Accession Numbers

Genbank: NM_001081556, NM_001128103; MGI: 3613666

Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R8024 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location110655201-110950923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 110667783 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 738 (E738K)
Ref Sequence ENSEMBL: ENSMUSP00000097219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099623]
Predicted Effect probably damaging
Transcript: ENSMUST00000099623
AA Change: E738K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968
AA Change: E738K

DomainStartEndE-ValueType
Pfam:Anoct_dimer 156 381 2.9e-70 PFAM
Pfam:Anoctamin 384 950 4.4e-138 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TMEM16 family of predicted membrane proteins, that are also known as anoctamins. While little is known about the function of this gene, mutations in this gene have been associated with some cases of autosomal dominant craniocervical dystonia. Cells from individuals with a mutation in this gene exhibited abnormalities in endoplasmic reticulum-dependent calcium signaling. Studies in rat show that the rat ortholog of this protein interacts with, and modulates the activity of a sodium-activated potassium channel. Deletion of this gene caused increased pain sensitivity in the rat model system. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,612,594 N1257Y probably benign Het
2310057J18Rik A T 10: 28,982,595 Y133* probably null Het
2310057J18Rik A C 10: 28,986,217 S26A possibly damaging Het
4931409K22Rik A G 5: 24,550,636 M296T possibly damaging Het
9930012K11Rik G T 14: 70,156,667 P220T probably damaging Het
A430105I19Rik A G 2: 118,760,524 probably null Het
Adam1b A C 5: 121,500,923 S686R probably benign Het
Adam8 T C 7: 139,987,576 D418G probably damaging Het
Adcy8 A G 15: 64,920,246 L287P probably damaging Het
Adhfe1 T A 1: 9,563,855 M373K probably benign Het
Alpk2 T C 18: 65,305,035 S1096G probably benign Het
Ankmy1 A G 1: 92,884,994 V531A probably benign Het
Ano4 T A 10: 88,971,332 I796F probably damaging Het
Apeh T C 9: 108,092,591 E190G probably benign Het
Cadm3 A G 1: 173,338,055 L346P probably damaging Het
Clec2e G A 6: 129,094,425 H150Y possibly damaging Het
Cnga4 A T 7: 105,406,835 N318Y probably damaging Het
Cnr2 T A 4: 135,916,885 F91L probably damaging Het
Diaph3 T A 14: 86,656,399 E1147V probably damaging Het
Elmo2 T C 2: 165,291,855 T738A unknown Het
Exoc4 T A 6: 33,347,931 W387R probably damaging Het
Fam173b T C 15: 31,608,171 Y123H probably damaging Het
Focad T C 4: 88,397,000 V1379A unknown Het
Frmd4a T C 2: 4,603,702 S794P probably damaging Het
Ftl1-ps1 A G 13: 74,407,051 T150A probably benign Het
Gm5773 C T 3: 93,773,168 A49V probably benign Het
Helz T A 11: 107,686,421 L1867Q unknown Het
Il22ra1 A G 4: 135,734,278 H118R probably benign Het
Inf2 C T 12: 112,608,902 P856S unknown Het
Ints5 T A 19: 8,896,140 L488I probably damaging Het
Kifc1 G A 17: 33,883,203 R479C probably damaging Het
Lrba T A 3: 86,295,401 C289* probably null Het
Mael A G 1: 166,226,627 L196S probably damaging Het
Med23 T A 10: 24,879,683 S229R possibly damaging Het
Mroh9 T C 1: 163,039,233 N645D probably benign Het
Myom3 G A 4: 135,801,748 V1132I probably benign Het
Ndufa13 A T 8: 69,894,537 L71H probably damaging Het
Nepro A T 16: 44,731,415 H212L probably benign Het
Nox4 T A 7: 87,304,910 L141Q probably damaging Het
Olfr1254 T C 2: 89,789,046 E102G probably benign Het
Olfr283 T A 15: 98,378,997 M38L probably benign Het
Olfr473 T C 7: 107,934,438 V306A probably benign Het
Olfr482 T A 7: 108,095,289 T94S probably benign Het
Olfr811 T G 10: 129,801,943 E194A probably damaging Het
Pfpl A G 19: 12,430,206 D607G possibly damaging Het
Pkd1l2 A T 8: 117,076,182 F233L possibly damaging Het
Ptprz1 A T 6: 23,042,751 E2058V probably damaging Het
Rag1 A T 2: 101,642,507 N763K probably damaging Het
Rhbg A C 3: 88,248,453 D63E probably damaging Het
Rrm1 T A 7: 102,457,265 F330L probably benign Het
Scaf8 A T 17: 3,159,293 Q97L unknown Het
Sdr9c7 G A 10: 127,898,882 V80I probably benign Het
Slc18a1 A G 8: 69,075,147 V4A probably benign Het
Slirp T C 12: 87,447,600 V45A probably damaging Het
Spata31 A T 13: 64,922,804 Q922L probably benign Het
Spg11 A G 2: 122,097,321 S661P possibly damaging Het
Stab2 G T 10: 86,846,052 T2495K probably benign Het
Supt16 A G 14: 52,170,875 I871T probably damaging Het
Sval2 A G 6: 41,860,364 Q9R probably damaging Het
Syngap1 A T 17: 26,941,452 M1L probably benign Het
Tfpi A T 2: 84,453,922 M62K possibly damaging Het
Tm4sf1 A T 3: 57,287,765 Y200* probably null Het
Tmc1 A T 19: 20,900,817 W105R probably damaging Het
Tmtc2 T C 10: 105,190,126 E827G probably benign Het
Tollip T C 7: 141,892,826 I33V probably benign Het
Unc80 T A 1: 66,606,644 V1493D possibly damaging Het
Vmn2r6 G A 3: 64,559,824 R85W probably benign Het
Vwa5a C A 9: 38,736,020 S565* probably null Het
Xbp1 T A 11: 5,521,910 V12D probably benign Het
Other mutations in Ano3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ano3 APN 2 110771050 splice site probably benign
IGL01066:Ano3 APN 2 110661445 missense probably null 0.00
IGL01696:Ano3 APN 2 110667737 missense probably damaging 1.00
IGL01729:Ano3 APN 2 110781394 splice site probably null
IGL01785:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01786:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01992:Ano3 APN 2 110658219 missense probably damaging 1.00
IGL02098:Ano3 APN 2 110666441 nonsense probably null
IGL02333:Ano3 APN 2 110697199 splice site probably benign
IGL02346:Ano3 APN 2 110770926 splice site probably benign
IGL02352:Ano3 APN 2 110884943 nonsense probably null
IGL02359:Ano3 APN 2 110884943 nonsense probably null
IGL02544:Ano3 APN 2 110658249 missense possibly damaging 0.79
IGL02750:Ano3 APN 2 110665984 splice site probably benign
IGL02861:Ano3 APN 2 110738812 missense probably damaging 1.00
IGL02948:Ano3 APN 2 110697018 splice site probably benign
IGL03327:Ano3 APN 2 110697178 missense possibly damaging 0.62
3-1:Ano3 UTSW 2 110697124 missense probably damaging 1.00
IGL02988:Ano3 UTSW 2 110775010 missense probably damaging 1.00
IGL03147:Ano3 UTSW 2 110697418 missense probably damaging 1.00
R0349:Ano3 UTSW 2 110661487 missense probably damaging 1.00
R0426:Ano3 UTSW 2 110661174 missense probably damaging 1.00
R0523:Ano3 UTSW 2 110884855 missense probably benign 0.13
R0557:Ano3 UTSW 2 110862952 splice site probably null
R0611:Ano3 UTSW 2 110885001 missense possibly damaging 0.93
R0891:Ano3 UTSW 2 110697976 missense probably benign 0.03
R1459:Ano3 UTSW 2 110880829 missense probably benign 0.00
R1460:Ano3 UTSW 2 110682758 missense probably damaging 0.97
R1773:Ano3 UTSW 2 110761455 missense probably damaging 1.00
R1874:Ano3 UTSW 2 110884872 missense probably benign 0.00
R1919:Ano3 UTSW 2 110885007 missense probably benign
R2185:Ano3 UTSW 2 110775045 missense probably benign 0.01
R2280:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2281:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2348:Ano3 UTSW 2 110783743 missense possibly damaging 0.82
R2425:Ano3 UTSW 2 110862843 missense probably benign
R2697:Ano3 UTSW 2 110794960 missense possibly damaging 0.79
R3888:Ano3 UTSW 2 110885000 missense probably damaging 0.99
R3923:Ano3 UTSW 2 110770959 missense probably damaging 1.00
R4352:Ano3 UTSW 2 110745894 missense possibly damaging 0.74
R4447:Ano3 UTSW 2 110761578 unclassified probably null
R4790:Ano3 UTSW 2 110884919 missense probably benign
R4832:Ano3 UTSW 2 110667722 missense probably damaging 1.00
R4916:Ano3 UTSW 2 110771020 missense possibly damaging 0.74
R5113:Ano3 UTSW 2 110661480 missense possibly damaging 0.61
R5486:Ano3 UTSW 2 110745870 missense probably damaging 1.00
R5498:Ano3 UTSW 2 110697103 missense possibly damaging 0.68
R5589:Ano3 UTSW 2 110884995 missense probably damaging 0.99
R5627:Ano3 UTSW 2 110756953 missense possibly damaging 0.61
R5741:Ano3 UTSW 2 110658273 missense probably benign 0.11
R5767:Ano3 UTSW 2 110661271 missense probably damaging 1.00
R5883:Ano3 UTSW 2 110880864 missense probably null 0.15
R5899:Ano3 UTSW 2 110862887 missense probably benign 0.39
R5916:Ano3 UTSW 2 110681836 missense probably benign 0.29
R6158:Ano3 UTSW 2 110665875 missense probably damaging 1.00
R6315:Ano3 UTSW 2 110697039 missense probably damaging 1.00
R6401:Ano3 UTSW 2 110775114 missense probably benign 0.01
R6481:Ano3 UTSW 2 110795027 missense probably benign 0.16
R6482:Ano3 UTSW 2 110697055 missense probably damaging 1.00
R6587:Ano3 UTSW 2 110797904 intron probably null
R6811:Ano3 UTSW 2 110880867 missense probably benign 0.03
R7048:Ano3 UTSW 2 110682771 nonsense probably null
R7145:Ano3 UTSW 2 110862860 missense probably benign 0.31
R7207:Ano3 UTSW 2 110781423 missense probably damaging 0.96
R7215:Ano3 UTSW 2 110665932 missense probably damaging 1.00
R7366:Ano3 UTSW 2 110757067 missense probably damaging 1.00
R7371:Ano3 UTSW 2 110884849 critical splice donor site probably null
R7568:Ano3 UTSW 2 110950293 start gained probably benign
R7636:Ano3 UTSW 2 110682703 nonsense probably null
R7888:Ano3 UTSW 2 110666428 missense probably damaging 1.00
R7971:Ano3 UTSW 2 110666428 missense probably damaging 1.00
R8074:Ano3 UTSW 2 110950232 start gained probably benign
RF012:Ano3 UTSW 2 110697523 missense possibly damaging 0.83
RF013:Ano3 UTSW 2 110697036 missense probably benign 0.30
X0058:Ano3 UTSW 2 110697418 missense probably damaging 1.00
Z1088:Ano3 UTSW 2 110745847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAGAATGCTCAGGGCTGG -3'
(R):5'- AGCCATTTACTATCTTCAGTTCCAGG -3'

Sequencing Primer
(F):5'- CTCAGGGCTGGAAAGAGTATTGTC -3'
(R):5'- TCTTCAGTTCCAGGAATACTTGAC -3'
Posted On2020-01-23