Incidental Mutation 'R8024:Elmo2'
ID617563
Institutional Source Beutler Lab
Gene Symbol Elmo2
Ensembl Gene ENSMUSG00000017670
Gene Nameengulfment and cell motility 2
SynonymsCED-12, 1190002F24Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R8024 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location165288031-165326479 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 165291855 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 738 (T738A)
Ref Sequence ENSEMBL: ENSMUSP00000071619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017808] [ENSMUST00000071699] [ENSMUST00000074046] [ENSMUST00000094329] [ENSMUST00000103088] [ENSMUST00000103091] [ENSMUST00000109298] [ENSMUST00000109299] [ENSMUST00000109300] [ENSMUST00000130393] [ENSMUST00000131409] [ENSMUST00000132270] [ENSMUST00000133961] [ENSMUST00000156134]
Predicted Effect probably benign
Transcript: ENSMUST00000017808
SMART Domains Protein: ENSMUSP00000017808
Gene: ENSMUSG00000017664

DomainStartEndE-ValueType
Pfam:UAA 15 320 3.5e-10 PFAM
Pfam:TPT 165 315 6.9e-37 PFAM
low complexity region 339 356 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000071699
AA Change: T738A
SMART Domains Protein: ENSMUSP00000071619
Gene: ENSMUSG00000017670
AA Change: T738A

DomainStartEndE-ValueType
Pfam:DUF3361 115 272 1.6e-61 PFAM
Pfam:ELMO_CED12 295 474 3.2e-39 PFAM
Pfam:PH_12 541 657 5.4e-33 PFAM
internal_repeat_1 670 688 6.69e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000074046
SMART Domains Protein: ENSMUSP00000073691
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:DUF3361 114 285 2.7e-75 PFAM
Pfam:ELMO_CED12 304 487 3.7e-48 PFAM
PDB:3A98|D 535 729 3e-99 PDB
SCOP:d1mai__ 552 677 4e-33 SMART
Blast:PH 560 681 2e-82 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000094329
SMART Domains Protein: ENSMUSP00000091887
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:DUF3361 114 273 5.6e-77 PFAM
Pfam:ELMO_CED12 292 475 3.6e-48 PFAM
PDB:3A98|D 523 717 2e-99 PDB
SCOP:d1mai__ 540 665 5e-33 SMART
Blast:PH 548 669 1e-82 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000103088
AA Change: T738A
SMART Domains Protein: ENSMUSP00000099377
Gene: ENSMUSG00000017670
AA Change: T738A

DomainStartEndE-ValueType
Pfam:DUF3361 114 273 6.6e-77 PFAM
Pfam:ELMO_CED12 292 475 4.3e-48 PFAM
internal_repeat_1 654 672 6.69e-7 PROSPERO
internal_repeat_1 670 688 6.69e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000103091
SMART Domains Protein: ENSMUSP00000099380
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:DUF3361 114 273 5.6e-77 PFAM
Pfam:ELMO_CED12 292 475 3.6e-48 PFAM
PDB:3A98|D 523 717 2e-99 PDB
SCOP:d1mai__ 540 665 5e-33 SMART
Blast:PH 548 669 1e-82 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109298
SMART Domains Protein: ENSMUSP00000104921
Gene: ENSMUSG00000017664

DomainStartEndE-ValueType
Pfam:UAA 15 320 3.5e-10 PFAM
Pfam:TPT 165 315 6.9e-37 PFAM
low complexity region 339 356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109299
SMART Domains Protein: ENSMUSP00000104922
Gene: ENSMUSG00000017664

DomainStartEndE-ValueType
Pfam:UAA 15 320 3.5e-10 PFAM
Pfam:TPT 165 315 6.9e-37 PFAM
low complexity region 339 356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109300
SMART Domains Protein: ENSMUSP00000104923
Gene: ENSMUSG00000017664

DomainStartEndE-ValueType
Pfam:TPT 15 314 2.7e-27 PFAM
Pfam:EamA 164 315 1.6e-8 PFAM
low complexity region 339 356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130393
SMART Domains Protein: ENSMUSP00000123450
Gene: ENSMUSG00000017664

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131409
SMART Domains Protein: ENSMUSP00000120036
Gene: ENSMUSG00000017664

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132270
SMART Domains Protein: ENSMUSP00000125708
Gene: ENSMUSG00000017664

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133961
SMART Domains Protein: ENSMUSP00000118227
Gene: ENSMUSG00000017664

DomainStartEndE-ValueType
Pfam:UAA 15 188 9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148643
SMART Domains Protein: ENSMUSP00000117124
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:ELMO_CED12 2 48 9.6e-10 PFAM
Pfam:PH_12 115 237 1.3e-35 PFAM
low complexity region 270 280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156134
SMART Domains Protein: ENSMUSP00000116288
Gene: ENSMUSG00000017664

DomainStartEndE-ValueType
Pfam:UAA 15 188 9e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the dedicator of cyto-kinesis 1 protein. Similarity to a C. elegans protein suggests that this protein may function in phagocytosis of apoptotic cells and in cell migration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,612,594 N1257Y probably benign Het
2310057J18Rik A T 10: 28,982,595 Y133* probably null Het
2310057J18Rik A C 10: 28,986,217 S26A possibly damaging Het
4931409K22Rik A G 5: 24,550,636 M296T possibly damaging Het
9930012K11Rik G T 14: 70,156,667 P220T probably damaging Het
A430105I19Rik A G 2: 118,760,524 probably null Het
Adam1b A C 5: 121,500,923 S686R probably benign Het
Adam8 T C 7: 139,987,576 D418G probably damaging Het
Adcy8 A G 15: 64,920,246 L287P probably damaging Het
Adhfe1 T A 1: 9,563,855 M373K probably benign Het
Alpk2 T C 18: 65,305,035 S1096G probably benign Het
Ankmy1 A G 1: 92,884,994 V531A probably benign Het
Ano3 C T 2: 110,667,783 E738K probably damaging Het
Ano4 T A 10: 88,971,332 I796F probably damaging Het
Apeh T C 9: 108,092,591 E190G probably benign Het
Cadm3 A G 1: 173,338,055 L346P probably damaging Het
Clec2e G A 6: 129,094,425 H150Y possibly damaging Het
Cnga4 A T 7: 105,406,835 N318Y probably damaging Het
Cnr2 T A 4: 135,916,885 F91L probably damaging Het
Diaph3 T A 14: 86,656,399 E1147V probably damaging Het
Exoc4 T A 6: 33,347,931 W387R probably damaging Het
Fam173b T C 15: 31,608,171 Y123H probably damaging Het
Focad T C 4: 88,397,000 V1379A unknown Het
Frmd4a T C 2: 4,603,702 S794P probably damaging Het
Ftl1-ps1 A G 13: 74,407,051 T150A probably benign Het
Gm5773 C T 3: 93,773,168 A49V probably benign Het
Helz T A 11: 107,686,421 L1867Q unknown Het
Il22ra1 A G 4: 135,734,278 H118R probably benign Het
Inf2 C T 12: 112,608,902 P856S unknown Het
Ints5 T A 19: 8,896,140 L488I probably damaging Het
Kifc1 G A 17: 33,883,203 R479C probably damaging Het
Lrba T A 3: 86,295,401 C289* probably null Het
Mael A G 1: 166,226,627 L196S probably damaging Het
Med23 T A 10: 24,879,683 S229R possibly damaging Het
Mroh9 T C 1: 163,039,233 N645D probably benign Het
Myom3 G A 4: 135,801,748 V1132I probably benign Het
Ndufa13 A T 8: 69,894,537 L71H probably damaging Het
Nepro A T 16: 44,731,415 H212L probably benign Het
Nox4 T A 7: 87,304,910 L141Q probably damaging Het
Olfr1254 T C 2: 89,789,046 E102G probably benign Het
Olfr283 T A 15: 98,378,997 M38L probably benign Het
Olfr473 T C 7: 107,934,438 V306A probably benign Het
Olfr482 T A 7: 108,095,289 T94S probably benign Het
Olfr811 T G 10: 129,801,943 E194A probably damaging Het
Pfpl A G 19: 12,430,206 D607G possibly damaging Het
Pkd1l2 A T 8: 117,076,182 F233L possibly damaging Het
Ptprz1 A T 6: 23,042,751 E2058V probably damaging Het
Rag1 A T 2: 101,642,507 N763K probably damaging Het
Rhbg A C 3: 88,248,453 D63E probably damaging Het
Rrm1 T A 7: 102,457,265 F330L probably benign Het
Scaf8 A T 17: 3,159,293 Q97L unknown Het
Sdr9c7 G A 10: 127,898,882 V80I probably benign Het
Slc18a1 A G 8: 69,075,147 V4A probably benign Het
Slirp T C 12: 87,447,600 V45A probably damaging Het
Spata31 A T 13: 64,922,804 Q922L probably benign Het
Spg11 A G 2: 122,097,321 S661P possibly damaging Het
Stab2 G T 10: 86,846,052 T2495K probably benign Het
Supt16 A G 14: 52,170,875 I871T probably damaging Het
Sval2 A G 6: 41,860,364 Q9R probably damaging Het
Syngap1 A T 17: 26,941,452 M1L probably benign Het
Tfpi A T 2: 84,453,922 M62K possibly damaging Het
Tm4sf1 A T 3: 57,287,765 Y200* probably null Het
Tmc1 A T 19: 20,900,817 W105R probably damaging Het
Tmtc2 T C 10: 105,190,126 E827G probably benign Het
Tollip T C 7: 141,892,826 I33V probably benign Het
Unc80 T A 1: 66,606,644 V1493D possibly damaging Het
Vmn2r6 G A 3: 64,559,824 R85W probably benign Het
Vwa5a C A 9: 38,736,020 S565* probably null Het
Xbp1 T A 11: 5,521,910 V12D probably benign Het
Other mutations in Elmo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Elmo2 APN 2 165292014 unclassified probably benign
IGL01096:Elmo2 APN 2 165296987 unclassified probably benign
IGL01694:Elmo2 APN 2 165314773 missense probably benign 0.05
IGL02016:Elmo2 APN 2 165295012 critical splice donor site probably null
IGL02402:Elmo2 APN 2 165297392 missense probably damaging 0.97
IGL02808:Elmo2 APN 2 165291707 unclassified probably benign
IGL03030:Elmo2 APN 2 165294317 missense possibly damaging 0.93
IGL03117:Elmo2 APN 2 165298653 missense probably benign 0.01
R0046:Elmo2 UTSW 2 165298726 missense probably damaging 0.97
R0046:Elmo2 UTSW 2 165298726 missense probably damaging 0.97
R0278:Elmo2 UTSW 2 165297367 missense probably damaging 1.00
R0281:Elmo2 UTSW 2 165296890 missense probably damaging 1.00
R0472:Elmo2 UTSW 2 165298330 missense probably damaging 0.99
R0570:Elmo2 UTSW 2 165304919 missense probably benign 0.38
R1799:Elmo2 UTSW 2 165292157 missense probably damaging 1.00
R1940:Elmo2 UTSW 2 165292050 unclassified probably benign
R2005:Elmo2 UTSW 2 165298279 missense probably benign 0.00
R2504:Elmo2 UTSW 2 165298687 missense probably damaging 0.96
R2915:Elmo2 UTSW 2 165297653 unclassified probably benign
R3744:Elmo2 UTSW 2 165316002 missense probably damaging 0.96
R4027:Elmo2 UTSW 2 165294249 nonsense probably null
R4419:Elmo2 UTSW 2 165311755 unclassified probably null
R4824:Elmo2 UTSW 2 165292002 unclassified probably benign
R4888:Elmo2 UTSW 2 165295289 missense probably benign 0.14
R4950:Elmo2 UTSW 2 165314813 unclassified probably null
R5157:Elmo2 UTSW 2 165291707 unclassified probably benign
R5535:Elmo2 UTSW 2 165310212 missense possibly damaging 0.51
R5682:Elmo2 UTSW 2 165297410 missense probably damaging 1.00
R5840:Elmo2 UTSW 2 165295552 missense possibly damaging 0.64
R5868:Elmo2 UTSW 2 165294272 missense possibly damaging 0.89
R7022:Elmo2 UTSW 2 165295041 missense probably damaging 0.99
R7089:Elmo2 UTSW 2 165304929 missense possibly damaging 0.78
R7678:Elmo2 UTSW 2 165291744 missense unknown
Predicted Primers PCR Primer
(F):5'- TTGACTGAGTTGGGCACTAGC -3'
(R):5'- CCTTGAACACCAGTGCTCTC -3'

Sequencing Primer
(F):5'- TGAGTTGGGCACTAGCACCTTC -3'
(R):5'- TGCTCTCACTGTGAGGAGG -3'
Posted On2020-01-23