Incidental Mutation 'R8024:Rhbg'
ID617567
Institutional Source Beutler Lab
Gene Symbol Rhbg
Ensembl Gene ENSMUSG00000104445
Gene NameRhesus blood group-associated B glycoprotein
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8024 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location88242874-88254709 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 88248453 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 63 (D63E)
Ref Sequence ENSEMBL: ENSMUSP00000130767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171887]
Predicted Effect probably benign
Transcript: ENSMUST00000163277
Predicted Effect
SMART Domains Protein: ENSMUSP00000132187
Gene: ENSMUSG00000103766
AA Change: D41E

DomainStartEndE-ValueType
Pfam:Ammonium_transp 1 353 9.7e-70 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171887
AA Change: D63E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130767
Gene: ENSMUSG00000104445
AA Change: D63E

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
Pfam:Ammonium_transp 22 419 5.9e-74 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two non-erythroid members of the Rhesus (Rh) protein family. Non-erythroid Rh protein family members are mainly expressed in the kidney and belong to the methylammonium-ammonium permease/ammonia transporters superfamily. All Rh family proteins are predicted to be transmembrane proteins with 12 membrane spanning domains and intracytoplasmic N- and C-termini. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, do not develop hyperammonemic hepatic encephalopathy or distal tubular acidosis, and show a normal renal response to chronic acid-loading and no changes in NH4+ or NH3 entry across the basolateral membrane of cortical collecting ducts cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,612,594 N1257Y probably benign Het
2310057J18Rik A T 10: 28,982,595 Y133* probably null Het
2310057J18Rik A C 10: 28,986,217 S26A possibly damaging Het
4931409K22Rik A G 5: 24,550,636 M296T possibly damaging Het
9930012K11Rik G T 14: 70,156,667 P220T probably damaging Het
A430105I19Rik A G 2: 118,760,524 probably null Het
Adam1b A C 5: 121,500,923 S686R probably benign Het
Adam8 T C 7: 139,987,576 D418G probably damaging Het
Adcy8 A G 15: 64,920,246 L287P probably damaging Het
Adhfe1 T A 1: 9,563,855 M373K probably benign Het
Alpk2 T C 18: 65,305,035 S1096G probably benign Het
Ankmy1 A G 1: 92,884,994 V531A probably benign Het
Ano3 C T 2: 110,667,783 E738K probably damaging Het
Ano4 T A 10: 88,971,332 I796F probably damaging Het
Apeh T C 9: 108,092,591 E190G probably benign Het
Cadm3 A G 1: 173,338,055 L346P probably damaging Het
Clec2e G A 6: 129,094,425 H150Y possibly damaging Het
Cnga4 A T 7: 105,406,835 N318Y probably damaging Het
Cnr2 T A 4: 135,916,885 F91L probably damaging Het
Diaph3 T A 14: 86,656,399 E1147V probably damaging Het
Elmo2 T C 2: 165,291,855 T738A unknown Het
Exoc4 T A 6: 33,347,931 W387R probably damaging Het
Fam173b T C 15: 31,608,171 Y123H probably damaging Het
Focad T C 4: 88,397,000 V1379A unknown Het
Frmd4a T C 2: 4,603,702 S794P probably damaging Het
Ftl1-ps1 A G 13: 74,407,051 T150A probably benign Het
Gm5773 C T 3: 93,773,168 A49V probably benign Het
Helz T A 11: 107,686,421 L1867Q unknown Het
Il22ra1 A G 4: 135,734,278 H118R probably benign Het
Inf2 C T 12: 112,608,902 P856S unknown Het
Ints5 T A 19: 8,896,140 L488I probably damaging Het
Kifc1 G A 17: 33,883,203 R479C probably damaging Het
Lrba T A 3: 86,295,401 C289* probably null Het
Mael A G 1: 166,226,627 L196S probably damaging Het
Med23 T A 10: 24,879,683 S229R possibly damaging Het
Mroh9 T C 1: 163,039,233 N645D probably benign Het
Myom3 G A 4: 135,801,748 V1132I probably benign Het
Ndufa13 A T 8: 69,894,537 L71H probably damaging Het
Nepro A T 16: 44,731,415 H212L probably benign Het
Nox4 T A 7: 87,304,910 L141Q probably damaging Het
Olfr1254 T C 2: 89,789,046 E102G probably benign Het
Olfr283 T A 15: 98,378,997 M38L probably benign Het
Olfr473 T C 7: 107,934,438 V306A probably benign Het
Olfr482 T A 7: 108,095,289 T94S probably benign Het
Olfr811 T G 10: 129,801,943 E194A probably damaging Het
Pfpl A G 19: 12,430,206 D607G possibly damaging Het
Pkd1l2 A T 8: 117,076,182 F233L possibly damaging Het
Ptprz1 A T 6: 23,042,751 E2058V probably damaging Het
Rag1 A T 2: 101,642,507 N763K probably damaging Het
Rrm1 T A 7: 102,457,265 F330L probably benign Het
Scaf8 A T 17: 3,159,293 Q97L unknown Het
Sdr9c7 G A 10: 127,898,882 V80I probably benign Het
Slc18a1 A G 8: 69,075,147 V4A probably benign Het
Slirp T C 12: 87,447,600 V45A probably damaging Het
Spata31 A T 13: 64,922,804 Q922L probably benign Het
Spg11 A G 2: 122,097,321 S661P possibly damaging Het
Stab2 G T 10: 86,846,052 T2495K probably benign Het
Supt16 A G 14: 52,170,875 I871T probably damaging Het
Sval2 A G 6: 41,860,364 Q9R probably damaging Het
Syngap1 A T 17: 26,941,452 M1L probably benign Het
Tfpi A T 2: 84,453,922 M62K possibly damaging Het
Tm4sf1 A T 3: 57,287,765 Y200* probably null Het
Tmc1 A T 19: 20,900,817 W105R probably damaging Het
Tmtc2 T C 10: 105,190,126 E827G probably benign Het
Tollip T C 7: 141,892,826 I33V probably benign Het
Unc80 T A 1: 66,606,644 V1493D possibly damaging Het
Vmn2r6 G A 3: 64,559,824 R85W probably benign Het
Vwa5a C A 9: 38,736,020 S565* probably null Het
Xbp1 T A 11: 5,521,910 V12D probably benign Het
Other mutations in Rhbg
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0496:Rhbg UTSW 3 88254498 missense probably benign
R0786:Rhbg UTSW 3 88244568 missense probably benign 0.04
R1397:Rhbg UTSW 3 88248446 missense probably benign 0.14
R1737:Rhbg UTSW 3 88245874 missense probably damaging 1.00
R1927:Rhbg UTSW 3 88244552 missense probably benign 0.00
R2088:Rhbg UTSW 3 88247458 missense probably damaging 1.00
R3976:Rhbg UTSW 3 88244536 missense probably damaging 1.00
R4056:Rhbg UTSW 3 88243448 missense probably damaging 1.00
R4669:Rhbg UTSW 3 88245966 missense probably damaging 1.00
R4878:Rhbg UTSW 3 88247453 missense probably benign 0.43
R5032:Rhbg UTSW 3 88245134 missense probably damaging 1.00
R5330:Rhbg UTSW 3 88245468 missense probably benign 0.10
R5331:Rhbg UTSW 3 88245468 missense probably benign 0.10
R5788:Rhbg UTSW 3 88245567 missense probably benign 0.00
R6293:Rhbg UTSW 3 88245826 nonsense probably null
R6882:Rhbg UTSW 3 88245220 missense probably damaging 1.00
R7493:Rhbg UTSW 3 88247579 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACGCCAACATGGATGTG -3'
(R):5'- CTTCTCTGAGCAGGGATAACAAGG -3'

Sequencing Primer
(F):5'- AACATGGATGTGGCCACC -3'
(R):5'- TGCTGCTCCAGGCTGAATG -3'
Posted On2020-01-23