Incidental Mutation 'R0680:Olfr810'
ID61757
Institutional Source Beutler Lab
Gene Symbol Olfr810
Ensembl Gene ENSMUSG00000069421
Gene Nameolfactory receptor 810
SynonymsMOR113-4, GA_x6K02T2PULF-11470271-11469333
MMRRC Submission 038865-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R0680 (G1)
Quality Score142
Status Not validated
Chromosome10
Chromosomal Location129787289-129794917 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129790818 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 257 (Y257F)
Ref Sequence ENSEMBL: ENSMUSP00000150364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091986] [ENSMUST00000214206] [ENSMUST00000214878] [ENSMUST00000217283]
Predicted Effect probably damaging
Transcript: ENSMUST00000091986
AA Change: Y257F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089612
Gene: ENSMUSG00000069421
AA Change: Y257F

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 7.3e-50 PFAM
Pfam:7tm_1 39 288 5e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214206
AA Change: Y257F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214878
AA Change: Y257F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217283
AA Change: Y257F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik T A 10: 3,125,133 noncoding transcript Het
AI481877 T C 4: 59,043,967 D1449G probably benign Het
Clca4a A T 3: 144,969,367 F167L probably damaging Het
Col6a3 T C 1: 90,778,981 M2137V unknown Het
Dennd2a A T 6: 39,483,062 L703Q probably damaging Het
Fsip2 T A 2: 82,991,359 I5812N possibly damaging Het
Gen1 T A 12: 11,241,869 S640C probably benign Het
Il9 T C 13: 56,481,880 T61A probably benign Het
Lrp1 A G 10: 127,589,661 L700P probably damaging Het
Lyst G A 13: 13,650,341 V1514I probably benign Het
Med1 A T 11: 98,180,166 probably null Het
Olfr1205 A T 2: 88,831,780 Y221F probably benign Het
Olfr298 A T 7: 86,489,337 F71L probably benign Het
Olfr666 A G 7: 104,893,004 I208T probably benign Het
Pcdhb18 G C 18: 37,490,294 A226P probably damaging Het
Pirb T A 7: 3,717,361 N338Y possibly damaging Het
Rc3h2 A C 2: 37,399,835 I360R probably damaging Het
Rnf139 T C 15: 58,899,652 Y509H probably damaging Het
Shisa7 T A 7: 4,831,723 D279V probably benign Het
Slc6a3 T C 13: 73,538,727 L71P probably damaging Het
Slc9a5 T A 8: 105,355,907 L268Q probably null Het
St7 T C 6: 17,942,733 S563P probably damaging Het
Stx1b A G 7: 127,807,723 V240A possibly damaging Het
Sugt1 A G 14: 79,610,311 I200M possibly damaging Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Ube4a T A 9: 44,948,060 Q380L probably damaging Het
Ugt1a2 A G 1: 88,201,211 Y192C probably damaging Het
Unc93b1 G A 19: 3,947,093 V505I probably benign Het
Usp29 T C 7: 6,962,885 S576P possibly damaging Het
Vcan A T 13: 89,679,822 H2208Q probably damaging Het
Zcchc6 G A 13: 59,800,599 T636I possibly damaging Het
Zfp106 T A 2: 120,527,016 S1133C probably damaging Het
Zfp148 A G 16: 33,495,804 D282G possibly damaging Het
Zswim9 A C 7: 13,260,321 V636G probably benign Het
Other mutations in Olfr810
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Olfr810 APN 10 129791319 missense probably damaging 0.98
IGL02365:Olfr810 APN 10 129791535 missense possibly damaging 0.81
IGL02508:Olfr810 APN 10 129790791 missense probably benign 0.44
R0638:Olfr810 UTSW 10 129791232 missense probably damaging 1.00
R0847:Olfr810 UTSW 10 129791458 missense probably damaging 1.00
R1449:Olfr810 UTSW 10 129790854 missense probably damaging 1.00
R1776:Olfr810 UTSW 10 129791131 missense probably benign 0.00
R1938:Olfr810 UTSW 10 129790890 missense probably damaging 1.00
R3836:Olfr810 UTSW 10 129791170 missense probably benign 0.01
R4521:Olfr810 UTSW 10 129791181 missense possibly damaging 0.58
R4816:Olfr810 UTSW 10 129791439 missense probably damaging 1.00
R6287:Olfr810 UTSW 10 129791385 missense probably damaging 1.00
R8080:Olfr810 UTSW 10 129791128 missense probably benign 0.07
R8202:Olfr810 UTSW 10 129790649 makesense probably null
Predicted Primers PCR Primer
(F):5'- CACCAAAAGTGATGGACAAATCCTGGTA -3'
(R):5'- AGACACACAGCTCCTGGAAACAATG -3'

Sequencing Primer
(F):5'- AAGAGCATAGGTAGTTTATCTCTTGG -3'
(R):5'- CTCCTGGAAACAATGGGATTTGTC -3'
Posted On2013-07-30