Incidental Mutation 'R8024:Adam8'
ID617584
Institutional Source Beutler Lab
Gene Symbol Adam8
Ensembl Gene ENSMUSG00000025473
Gene Namea disintegrin and metallopeptidase domain 8
SynonymsCD156, MS2, E430039A18Rik, CD156a
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8024 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location139978932-139992562 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139987576 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 418 (D418G)
Ref Sequence ENSEMBL: ENSMUSP00000101684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026546] [ENSMUST00000106069] [ENSMUST00000148670] [ENSMUST00000173209]
Predicted Effect probably damaging
Transcript: ENSMUST00000026546
AA Change: D417G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026546
Gene: ENSMUSG00000025473
AA Change: D417G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 151 5.9e-35 PFAM
Pfam:Reprolysin_5 193 371 1e-22 PFAM
Pfam:Reprolysin_4 193 384 1.7e-16 PFAM
Pfam:Reprolysin 195 394 2.7e-70 PFAM
Pfam:Reprolysin_2 214 384 1.6e-16 PFAM
Pfam:Reprolysin_3 218 339 4.9e-21 PFAM
DISIN 411 486 5.16e-36 SMART
ACR 487 606 2.15e-35 SMART
EGF 613 642 3.06e-1 SMART
transmembrane domain 660 682 N/A INTRINSIC
low complexity region 732 762 N/A INTRINSIC
low complexity region 770 783 N/A INTRINSIC
low complexity region 784 812 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106069
AA Change: D418G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101684
Gene: ENSMUSG00000025473
AA Change: D418G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 28 152 4e-30 PFAM
Pfam:Reprolysin_5 194 372 9.6e-23 PFAM
Pfam:Reprolysin_4 194 385 1.6e-16 PFAM
Pfam:Reprolysin 196 395 2.2e-73 PFAM
Pfam:Reprolysin_2 215 385 2.9e-18 PFAM
Pfam:Reprolysin_3 219 340 6.6e-21 PFAM
DISIN 412 487 5.16e-36 SMART
ACR 488 607 2.15e-35 SMART
EGF 614 643 3.06e-1 SMART
transmembrane domain 661 683 N/A INTRINSIC
low complexity region 733 763 N/A INTRINSIC
low complexity region 771 784 N/A INTRINSIC
low complexity region 785 813 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000117858
Gene: ENSMUSG00000025473
AA Change: D417G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 151 1.8e-35 PFAM
Pfam:Reprolysin_5 193 371 3.6e-23 PFAM
Pfam:Reprolysin_4 193 384 6e-17 PFAM
Pfam:Reprolysin 195 394 8.2e-71 PFAM
Pfam:Reprolysin_2 214 384 5.8e-17 PFAM
Pfam:Reprolysin_3 218 339 1.7e-21 PFAM
DISIN 411 486 5.16e-36 SMART
ACR 487 612 2.21e-32 SMART
EGF 619 648 3.06e-1 SMART
transmembrane domain 666 688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173209
SMART Domains Protein: ENSMUSP00000133673
Gene: ENSMUSG00000025473

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 31 45 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Adam family of proteins that contain the disintegrin and metalloprotease domains. The encoded protein is localized to the cell surface, where it is involved in the remodeling of extracellular matrix and cell migration. Mice lacking the encoded protein display persistent inflammation upon treatment with allergens. Alternative splicing of this gene results in multiple variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Homozygous mutant mice do not exhibit any morphological or pathological abnormalities. Mice homozygous for a different knock-out allele exhibit reduced osteoclast differentiation and calvarial fibrosis in response to TNF-alpha treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,612,594 N1257Y probably benign Het
2310057J18Rik A T 10: 28,982,595 Y133* probably null Het
2310057J18Rik A C 10: 28,986,217 S26A possibly damaging Het
4931409K22Rik A G 5: 24,550,636 M296T possibly damaging Het
9930012K11Rik G T 14: 70,156,667 P220T probably damaging Het
A430105I19Rik A G 2: 118,760,524 probably null Het
Adam1b A C 5: 121,500,923 S686R probably benign Het
Adcy8 A G 15: 64,920,246 L287P probably damaging Het
Adhfe1 T A 1: 9,563,855 M373K probably benign Het
Alpk2 T C 18: 65,305,035 S1096G probably benign Het
Ankmy1 A G 1: 92,884,994 V531A probably benign Het
Ano3 C T 2: 110,667,783 E738K probably damaging Het
Ano4 T A 10: 88,971,332 I796F probably damaging Het
Apeh T C 9: 108,092,591 E190G probably benign Het
Cadm3 A G 1: 173,338,055 L346P probably damaging Het
Clec2e G A 6: 129,094,425 H150Y possibly damaging Het
Cnga4 A T 7: 105,406,835 N318Y probably damaging Het
Cnr2 T A 4: 135,916,885 F91L probably damaging Het
Diaph3 T A 14: 86,656,399 E1147V probably damaging Het
Elmo2 T C 2: 165,291,855 T738A unknown Het
Exoc4 T A 6: 33,347,931 W387R probably damaging Het
Fam173b T C 15: 31,608,171 Y123H probably damaging Het
Focad T C 4: 88,397,000 V1379A unknown Het
Frmd4a T C 2: 4,603,702 S794P probably damaging Het
Ftl1-ps1 A G 13: 74,407,051 T150A probably benign Het
Gm5773 C T 3: 93,773,168 A49V probably benign Het
Helz T A 11: 107,686,421 L1867Q unknown Het
Il22ra1 A G 4: 135,734,278 H118R probably benign Het
Inf2 C T 12: 112,608,902 P856S unknown Het
Ints5 T A 19: 8,896,140 L488I probably damaging Het
Kifc1 G A 17: 33,883,203 R479C probably damaging Het
Lrba T A 3: 86,295,401 C289* probably null Het
Mael A G 1: 166,226,627 L196S probably damaging Het
Med23 T A 10: 24,879,683 S229R possibly damaging Het
Mroh9 T C 1: 163,039,233 N645D probably benign Het
Myom3 G A 4: 135,801,748 V1132I probably benign Het
Ndufa13 A T 8: 69,894,537 L71H probably damaging Het
Nepro A T 16: 44,731,415 H212L probably benign Het
Nox4 T A 7: 87,304,910 L141Q probably damaging Het
Olfr1254 T C 2: 89,789,046 E102G probably benign Het
Olfr283 T A 15: 98,378,997 M38L probably benign Het
Olfr473 T C 7: 107,934,438 V306A probably benign Het
Olfr482 T A 7: 108,095,289 T94S probably benign Het
Olfr811 T G 10: 129,801,943 E194A probably damaging Het
Pfpl A G 19: 12,430,206 D607G possibly damaging Het
Pkd1l2 A T 8: 117,076,182 F233L possibly damaging Het
Ptprz1 A T 6: 23,042,751 E2058V probably damaging Het
Rag1 A T 2: 101,642,507 N763K probably damaging Het
Rhbg A C 3: 88,248,453 D63E probably damaging Het
Rrm1 T A 7: 102,457,265 F330L probably benign Het
Scaf8 A T 17: 3,159,293 Q97L unknown Het
Sdr9c7 G A 10: 127,898,882 V80I probably benign Het
Slc18a1 A G 8: 69,075,147 V4A probably benign Het
Slirp T C 12: 87,447,600 V45A probably damaging Het
Spata31 A T 13: 64,922,804 Q922L probably benign Het
Spg11 A G 2: 122,097,321 S661P possibly damaging Het
Stab2 G T 10: 86,846,052 T2495K probably benign Het
Supt16 A G 14: 52,170,875 I871T probably damaging Het
Sval2 A G 6: 41,860,364 Q9R probably damaging Het
Syngap1 A T 17: 26,941,452 M1L probably benign Het
Tfpi A T 2: 84,453,922 M62K possibly damaging Het
Tm4sf1 A T 3: 57,287,765 Y200* probably null Het
Tmc1 A T 19: 20,900,817 W105R probably damaging Het
Tmtc2 T C 10: 105,190,126 E827G probably benign Het
Tollip T C 7: 141,892,826 I33V probably benign Het
Unc80 T A 1: 66,606,644 V1493D possibly damaging Het
Vmn2r6 G A 3: 64,559,824 R85W probably benign Het
Vwa5a C A 9: 38,736,020 S565* probably null Het
Xbp1 T A 11: 5,521,910 V12D probably benign Het
Other mutations in Adam8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Adam8 APN 7 139987245 missense probably damaging 1.00
IGL02044:Adam8 APN 7 139982822 missense possibly damaging 0.85
IGL02228:Adam8 APN 7 139988806 splice site probably null
IGL02257:Adam8 APN 7 139987648 missense possibly damaging 0.88
IGL03101:Adam8 APN 7 139988543 missense possibly damaging 0.56
R0320:Adam8 UTSW 7 139986442 missense probably damaging 1.00
R0384:Adam8 UTSW 7 139986812 unclassified probably benign
R1169:Adam8 UTSW 7 139983929 missense probably benign 0.11
R1340:Adam8 UTSW 7 139991377 missense probably damaging 0.99
R1699:Adam8 UTSW 7 139983311 missense possibly damaging 0.72
R3725:Adam8 UTSW 7 139983868 missense possibly damaging 0.63
R3874:Adam8 UTSW 7 139987607 missense probably damaging 1.00
R4716:Adam8 UTSW 7 139983938 missense probably benign 0.31
R4754:Adam8 UTSW 7 139984780 missense possibly damaging 0.87
R4907:Adam8 UTSW 7 139989373 missense probably benign 0.03
R5345:Adam8 UTSW 7 139987639 missense probably benign 0.03
R5579:Adam8 UTSW 7 139988984 missense probably benign 0.03
R5696:Adam8 UTSW 7 139989246 missense probably benign 0.03
R5805:Adam8 UTSW 7 139985881 missense probably damaging 1.00
R5948:Adam8 UTSW 7 139987884 missense probably benign 0.07
R5991:Adam8 UTSW 7 139990287 missense probably damaging 1.00
R6280:Adam8 UTSW 7 139984807 missense probably damaging 0.99
R6456:Adam8 UTSW 7 139986788 missense possibly damaging 0.96
R7098:Adam8 UTSW 7 139979499 missense possibly damaging 0.53
R7105:Adam8 UTSW 7 139990055 missense probably benign 0.00
R7334:Adam8 UTSW 7 139988990 missense probably damaging 1.00
R7342:Adam8 UTSW 7 139986391 missense probably benign 0.00
R7382:Adam8 UTSW 7 139990107 missense possibly damaging 0.74
R7425:Adam8 UTSW 7 139992481 unclassified probably benign
R7507:Adam8 UTSW 7 139987178 critical splice donor site probably null
R7637:Adam8 UTSW 7 139985430 missense probably damaging 0.98
R7904:Adam8 UTSW 7 139987678 missense probably benign 0.17
R8176:Adam8 UTSW 7 139988873 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGGTCGAAGCTAATTTACCTCC -3'
(R):5'- CCTAACGTGGACATCCTTACCC -3'

Sequencing Primer
(F):5'- CCAAATCCCTTATAGGTTATTCGGGG -3'
(R):5'- GTGGACATCCTTACCCATAGC -3'
Posted On2020-01-23