Incidental Mutation 'R0680:Gen1'
ID61759
Institutional Source Beutler Lab
Gene Symbol Gen1
Ensembl Gene ENSMUSG00000051235
Gene NameGEN1, Holliday junction 5' flap endonuclease
Synonyms5830483C08Rik
MMRRC Submission 038865-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R0680 (G1)
Quality Score196
Status Not validated
Chromosome12
Chromosomal Location11238920-11265801 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 11241869 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 640 (S640C)
Ref Sequence ENSEMBL: ENSMUSP00000151310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166117] [ENSMUST00000218487] [ENSMUST00000218547]
Predicted Effect probably benign
Transcript: ENSMUST00000166117
AA Change: S705C

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000132098
Gene: ENSMUSG00000051235
AA Change: S705C

DomainStartEndE-ValueType
XPGN 1 96 9.13e-22 SMART
XPGI 122 193 5.32e-23 SMART
HhH2 195 229 2.87e-5 SMART
low complexity region 704 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218487
AA Change: S640C

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000218547
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rad2/xeroderma pigmentosum group G nuclease family, whose members are characterized by N-terminal and internal xeroderma pigmentosum group G nuclease domains followed by helix-hairpin-helix domains and disordered C-terminal domains. The protein encoded by this gene is involved in resolution of Holliday junctions, which are intermediate four-way structures that covalently link DNA during homologous recombination and double-strand break repair. The protein resolves Holliday junctions by creating dual incisions across the junction to produce nicked duplex products that can be ligated. In addition, this protein has been found to localize to centrosomes where it has been implicated in regulation of centrosome integrity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik T A 10: 3,125,133 noncoding transcript Het
AI481877 T C 4: 59,043,967 D1449G probably benign Het
Clca4a A T 3: 144,969,367 F167L probably damaging Het
Col6a3 T C 1: 90,778,981 M2137V unknown Het
Dennd2a A T 6: 39,483,062 L703Q probably damaging Het
Fsip2 T A 2: 82,991,359 I5812N possibly damaging Het
Il9 T C 13: 56,481,880 T61A probably benign Het
Lrp1 A G 10: 127,589,661 L700P probably damaging Het
Lyst G A 13: 13,650,341 V1514I probably benign Het
Med1 A T 11: 98,180,166 probably null Het
Olfr1205 A T 2: 88,831,780 Y221F probably benign Het
Olfr298 A T 7: 86,489,337 F71L probably benign Het
Olfr666 A G 7: 104,893,004 I208T probably benign Het
Olfr810 T A 10: 129,790,818 Y257F probably damaging Het
Pcdhb18 G C 18: 37,490,294 A226P probably damaging Het
Pirb T A 7: 3,717,361 N338Y possibly damaging Het
Rc3h2 A C 2: 37,399,835 I360R probably damaging Het
Rnf139 T C 15: 58,899,652 Y509H probably damaging Het
Shisa7 T A 7: 4,831,723 D279V probably benign Het
Slc6a3 T C 13: 73,538,727 L71P probably damaging Het
Slc9a5 T A 8: 105,355,907 L268Q probably null Het
St7 T C 6: 17,942,733 S563P probably damaging Het
Stx1b A G 7: 127,807,723 V240A possibly damaging Het
Sugt1 A G 14: 79,610,311 I200M possibly damaging Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Ube4a T A 9: 44,948,060 Q380L probably damaging Het
Ugt1a2 A G 1: 88,201,211 Y192C probably damaging Het
Unc93b1 G A 19: 3,947,093 V505I probably benign Het
Usp29 T C 7: 6,962,885 S576P possibly damaging Het
Vcan A T 13: 89,679,822 H2208Q probably damaging Het
Zcchc6 G A 13: 59,800,599 T636I possibly damaging Het
Zfp106 T A 2: 120,527,016 S1133C probably damaging Het
Zfp148 A G 16: 33,495,804 D282G possibly damaging Het
Zswim9 A C 7: 13,260,321 V636G probably benign Het
Other mutations in Gen1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Gen1 APN 12 11261067 missense probably damaging 1.00
IGL01308:Gen1 APN 12 11256870 missense probably damaging 1.00
IGL01384:Gen1 APN 12 11255241 missense probably benign 0.00
IGL01766:Gen1 APN 12 11256894 missense probably damaging 1.00
IGL02132:Gen1 APN 12 11241866 missense probably benign 0.37
IGL02191:Gen1 APN 12 11242296 missense probably benign 0.18
IGL02452:Gen1 APN 12 11242575 missense probably benign 0.02
IGL02479:Gen1 APN 12 11241935 missense probably benign 0.01
IGL02690:Gen1 APN 12 11241575 missense probably damaging 0.96
IGL03095:Gen1 APN 12 11248264 missense probably benign 0.38
PIT4520001:Gen1 UTSW 12 11241508 missense probably benign 0.12
R0014:Gen1 UTSW 12 11241641 missense probably benign 0.44
R0014:Gen1 UTSW 12 11241641 missense probably benign 0.44
R0355:Gen1 UTSW 12 11248354 splice site probably benign
R0891:Gen1 UTSW 12 11248354 splice site probably benign
R1192:Gen1 UTSW 12 11255218 missense probably damaging 0.97
R1353:Gen1 UTSW 12 11243219 missense probably benign 0.00
R1833:Gen1 UTSW 12 11248351 splice site probably benign
R1898:Gen1 UTSW 12 11241608 missense probably benign 0.10
R2138:Gen1 UTSW 12 11241621 missense probably damaging 1.00
R2185:Gen1 UTSW 12 11261040 missense probably null 0.95
R2409:Gen1 UTSW 12 11249164 missense possibly damaging 0.75
R2876:Gen1 UTSW 12 11242068 missense probably benign 0.13
R3815:Gen1 UTSW 12 11252033 missense possibly damaging 0.84
R4402:Gen1 UTSW 12 11242362 missense possibly damaging 0.71
R4572:Gen1 UTSW 12 11242418 missense probably damaging 0.99
R4900:Gen1 UTSW 12 11241560 missense probably benign 0.00
R5091:Gen1 UTSW 12 11246346 missense probably damaging 0.97
R5952:Gen1 UTSW 12 11260896 missense probably damaging 0.96
R6785:Gen1 UTSW 12 11262530 missense possibly damaging 0.89
R6869:Gen1 UTSW 12 11241441 missense probably benign 0.02
R7057:Gen1 UTSW 12 11242418 missense probably benign 0.21
R7155:Gen1 UTSW 12 11241832 missense probably benign 0.25
R7260:Gen1 UTSW 12 11256848 missense probably damaging 0.99
R7316:Gen1 UTSW 12 11241469 missense probably benign
R7512:Gen1 UTSW 12 11260976 missense possibly damaging 0.79
R7692:Gen1 UTSW 12 11242166 missense probably benign 0.22
R7800:Gen1 UTSW 12 11241862 missense probably benign 0.00
R8061:Gen1 UTSW 12 11261076 splice site probably benign
R8112:Gen1 UTSW 12 11254373 nonsense probably null
R8147:Gen1 UTSW 12 11255050 intron probably null
R8152:Gen1 UTSW 12 11243265 missense probably damaging 0.99
R8153:Gen1 UTSW 12 11260947 missense probably damaging 1.00
R8161:Gen1 UTSW 12 11241464 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GCAGCCCAACTTGAAGACTGGAAG -3'
(R):5'- TCAGAACAAGGGACCTCAGACAGTG -3'

Sequencing Primer
(F):5'- AAGACTGGAAGTCTTTACTGCTTTG -3'
(R):5'- AAGGGTCCGGTAGAGACCTTC -3'
Posted On2013-07-30