Incidental Mutation 'R8024:Tmtc2'
ID617596
Institutional Source Beutler Lab
Gene Symbol Tmtc2
Ensembl Gene ENSMUSG00000036019
Gene Nametransmembrane and tetratricopeptide repeat containing 2
SynonymsD330034A10Rik, 8430438D04Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R8024 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location105187663-105574451 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105190126 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 827 (E827G)
Ref Sequence ENSEMBL: ENSMUSP00000061919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061506]
Predicted Effect probably benign
Transcript: ENSMUST00000061506
AA Change: E827G

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000061919
Gene: ENSMUSG00000036019
AA Change: E827G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 223 245 N/A INTRINSIC
Pfam:DUF1736 247 321 7.3e-33 PFAM
transmembrane domain 393 415 N/A INTRINSIC
transmembrane domain 425 444 N/A INTRINSIC
TPR 493 526 1.6e-3 SMART
TPR 527 560 6.84e-3 SMART
TPR 561 594 2.52e-1 SMART
TPR 606 639 3.12e-6 SMART
TPR 643 676 3.99e1 SMART
TPR 677 710 7.12e-1 SMART
low complexity region 729 739 N/A INTRINSIC
TPR 745 778 1.51e1 SMART
TPR 779 812 1.43e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integral membrane protein localized to the endoplasmic reticulum (ER). The encoded protein contains many tetratricopeptide repeats, sequences known for being involved in protein-protein interactions. This protein binds both the calcium uptake pump SERCA2B and the carbohydrate-binding chaperone calnexin, and it appears to play a role in calcium homeostasis in the ER. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,612,594 N1257Y probably benign Het
2310057J18Rik A T 10: 28,982,595 Y133* probably null Het
2310057J18Rik A C 10: 28,986,217 S26A possibly damaging Het
4931409K22Rik A G 5: 24,550,636 M296T possibly damaging Het
9930012K11Rik G T 14: 70,156,667 P220T probably damaging Het
A430105I19Rik A G 2: 118,760,524 probably null Het
Adam1b A C 5: 121,500,923 S686R probably benign Het
Adam8 T C 7: 139,987,576 D418G probably damaging Het
Adcy8 A G 15: 64,920,246 L287P probably damaging Het
Adhfe1 T A 1: 9,563,855 M373K probably benign Het
Alpk2 T C 18: 65,305,035 S1096G probably benign Het
Ankmy1 A G 1: 92,884,994 V531A probably benign Het
Ano3 C T 2: 110,667,783 E738K probably damaging Het
Ano4 T A 10: 88,971,332 I796F probably damaging Het
Apeh T C 9: 108,092,591 E190G probably benign Het
Cadm3 A G 1: 173,338,055 L346P probably damaging Het
Clec2e G A 6: 129,094,425 H150Y possibly damaging Het
Cnga4 A T 7: 105,406,835 N318Y probably damaging Het
Cnr2 T A 4: 135,916,885 F91L probably damaging Het
Diaph3 T A 14: 86,656,399 E1147V probably damaging Het
Elmo2 T C 2: 165,291,855 T738A unknown Het
Exoc4 T A 6: 33,347,931 W387R probably damaging Het
Fam173b T C 15: 31,608,171 Y123H probably damaging Het
Focad T C 4: 88,397,000 V1379A unknown Het
Frmd4a T C 2: 4,603,702 S794P probably damaging Het
Ftl1-ps1 A G 13: 74,407,051 T150A probably benign Het
Gm5773 C T 3: 93,773,168 A49V probably benign Het
Helz T A 11: 107,686,421 L1867Q unknown Het
Il22ra1 A G 4: 135,734,278 H118R probably benign Het
Inf2 C T 12: 112,608,902 P856S unknown Het
Ints5 T A 19: 8,896,140 L488I probably damaging Het
Kifc1 G A 17: 33,883,203 R479C probably damaging Het
Lrba T A 3: 86,295,401 C289* probably null Het
Mael A G 1: 166,226,627 L196S probably damaging Het
Med23 T A 10: 24,879,683 S229R possibly damaging Het
Mroh9 T C 1: 163,039,233 N645D probably benign Het
Myom3 G A 4: 135,801,748 V1132I probably benign Het
Ndufa13 A T 8: 69,894,537 L71H probably damaging Het
Nepro A T 16: 44,731,415 H212L probably benign Het
Nox4 T A 7: 87,304,910 L141Q probably damaging Het
Olfr1254 T C 2: 89,789,046 E102G probably benign Het
Olfr283 T A 15: 98,378,997 M38L probably benign Het
Olfr473 T C 7: 107,934,438 V306A probably benign Het
Olfr482 T A 7: 108,095,289 T94S probably benign Het
Olfr811 T G 10: 129,801,943 E194A probably damaging Het
Pfpl A G 19: 12,430,206 D607G possibly damaging Het
Pkd1l2 A T 8: 117,076,182 F233L possibly damaging Het
Ptprz1 A T 6: 23,042,751 E2058V probably damaging Het
Rag1 A T 2: 101,642,507 N763K probably damaging Het
Rhbg A C 3: 88,248,453 D63E probably damaging Het
Rrm1 T A 7: 102,457,265 F330L probably benign Het
Scaf8 A T 17: 3,159,293 Q97L unknown Het
Sdr9c7 G A 10: 127,898,882 V80I probably benign Het
Slc18a1 A G 8: 69,075,147 V4A probably benign Het
Slirp T C 12: 87,447,600 V45A probably damaging Het
Spata31 A T 13: 64,922,804 Q922L probably benign Het
Spg11 A G 2: 122,097,321 S661P possibly damaging Het
Stab2 G T 10: 86,846,052 T2495K probably benign Het
Supt16 A G 14: 52,170,875 I871T probably damaging Het
Sval2 A G 6: 41,860,364 Q9R probably damaging Het
Syngap1 A T 17: 26,941,452 M1L probably benign Het
Tfpi A T 2: 84,453,922 M62K possibly damaging Het
Tm4sf1 A T 3: 57,287,765 Y200* probably null Het
Tmc1 A T 19: 20,900,817 W105R probably damaging Het
Tollip T C 7: 141,892,826 I33V probably benign Het
Unc80 T A 1: 66,606,644 V1493D possibly damaging Het
Vmn2r6 G A 3: 64,559,824 R85W probably benign Het
Vwa5a C A 9: 38,736,020 S565* probably null Het
Xbp1 T A 11: 5,521,910 V12D probably benign Het
Other mutations in Tmtc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Tmtc2 APN 10 105321446 missense possibly damaging 0.82
IGL01284:Tmtc2 APN 10 105271511 missense possibly damaging 0.56
IGL01317:Tmtc2 APN 10 105413785 missense probably damaging 1.00
IGL01327:Tmtc2 APN 10 105348479 missense probably benign 0.15
IGL01637:Tmtc2 APN 10 105370085 missense probably benign 0.00
IGL02176:Tmtc2 APN 10 105348493 missense probably benign 0.00
IGL02354:Tmtc2 APN 10 105271526 missense probably benign 0.00
IGL02361:Tmtc2 APN 10 105271526 missense probably benign 0.00
IGL02514:Tmtc2 APN 10 105190099 missense possibly damaging 0.94
IGL02540:Tmtc2 APN 10 105413339 missense probably benign 0.45
IGL02625:Tmtc2 APN 10 105370546 missense probably damaging 1.00
IGL02938:Tmtc2 APN 10 105413296 missense probably damaging 1.00
IGL02939:Tmtc2 APN 10 105370550 missense probably damaging 1.00
IGL03388:Tmtc2 APN 10 105321483 splice site probably benign
PIT4402001:Tmtc2 UTSW 10 105413407 missense probably damaging 1.00
PIT4449001:Tmtc2 UTSW 10 105303604 missense probably damaging 1.00
R1424:Tmtc2 UTSW 10 105413368 missense probably benign 0.00
R1462:Tmtc2 UTSW 10 105573705 nonsense probably null
R1462:Tmtc2 UTSW 10 105573705 nonsense probably null
R1529:Tmtc2 UTSW 10 105303658 missense probably damaging 1.00
R1903:Tmtc2 UTSW 10 105190108 missense probably benign 0.00
R2225:Tmtc2 UTSW 10 105370357 missense probably benign 0.22
R4280:Tmtc2 UTSW 10 105348433 critical splice donor site probably null
R4602:Tmtc2 UTSW 10 105413530 missense probably benign
R4603:Tmtc2 UTSW 10 105413530 missense probably benign
R4624:Tmtc2 UTSW 10 105303650 missense probably benign 0.04
R4625:Tmtc2 UTSW 10 105303650 missense probably benign 0.04
R4628:Tmtc2 UTSW 10 105303650 missense probably benign 0.04
R4629:Tmtc2 UTSW 10 105303650 missense probably benign 0.04
R5192:Tmtc2 UTSW 10 105190177 missense probably damaging 1.00
R5769:Tmtc2 UTSW 10 105370046 missense probably benign 0.00
R5846:Tmtc2 UTSW 10 105271441 intron probably benign
R5892:Tmtc2 UTSW 10 105413505 missense probably benign 0.08
R5897:Tmtc2 UTSW 10 105413598 missense probably damaging 1.00
R6362:Tmtc2 UTSW 10 105369970 missense probably damaging 1.00
R6391:Tmtc2 UTSW 10 105573690 missense probably benign 0.06
R6640:Tmtc2 UTSW 10 105573749 start codon destroyed probably benign 0.01
R6812:Tmtc2 UTSW 10 105413269 missense probably benign 0.01
R6975:Tmtc2 UTSW 10 105323002 missense probably benign 0.01
R7042:Tmtc2 UTSW 10 105370616 missense probably damaging 1.00
R7063:Tmtc2 UTSW 10 105348525 missense probably damaging 1.00
R7211:Tmtc2 UTSW 10 105573726 missense probably benign 0.31
R7288:Tmtc2 UTSW 10 105413608 missense probably damaging 1.00
R7576:Tmtc2 UTSW 10 105370621 missense probably damaging 1.00
R7728:Tmtc2 UTSW 10 105271497 critical splice donor site probably null
R7850:Tmtc2 UTSW 10 105573707 missense probably benign 0.01
R7933:Tmtc2 UTSW 10 105573707 missense probably benign 0.01
Z1176:Tmtc2 UTSW 10 105303622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGTGGATTCTCCCAGCAG -3'
(R):5'- ACGTTTGTCCTCCATGAAGG -3'

Sequencing Primer
(F):5'- AGTGGCAGTAACCATAGTGACCTTTG -3'
(R):5'- AGGAGCTCTTGAAATGGCCTC -3'
Posted On2020-01-23