Incidental Mutation 'R8024:Sdr9c7'
ID617597
Institutional Source Beutler Lab
Gene Symbol Sdr9c7
Ensembl Gene ENSMUSG00000040127
Gene Name4short chain dehydrogenase/reductase family 9C, member 7
SynonymsSdro, SDR-O, Rdhs, 1810054F20Rik, Rdh20
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R8024 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location127898518-127911761 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127898882 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 80 (V80I)
Ref Sequence ENSEMBL: ENSMUSP00000036628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047134]
Predicted Effect probably benign
Transcript: ENSMUST00000047134
AA Change: V80I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000036628
Gene: ENSMUSG00000040127
AA Change: V80I

DomainStartEndE-ValueType
Pfam:adh_short 26 217 3.2e-41 PFAM
Pfam:adh_short_C2 32 226 1.6e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with similarity to the short-chain dehydrogenase/reductase (SDR) family but has not been shown to have retinoid or dehydrogenase activities. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,612,594 N1257Y probably benign Het
2310057J18Rik A T 10: 28,982,595 Y133* probably null Het
2310057J18Rik A C 10: 28,986,217 S26A possibly damaging Het
4931409K22Rik A G 5: 24,550,636 M296T possibly damaging Het
9930012K11Rik G T 14: 70,156,667 P220T probably damaging Het
A430105I19Rik A G 2: 118,760,524 probably null Het
Adam1b A C 5: 121,500,923 S686R probably benign Het
Adam8 T C 7: 139,987,576 D418G probably damaging Het
Adcy8 A G 15: 64,920,246 L287P probably damaging Het
Adhfe1 T A 1: 9,563,855 M373K probably benign Het
Alpk2 T C 18: 65,305,035 S1096G probably benign Het
Ankmy1 A G 1: 92,884,994 V531A probably benign Het
Ano3 C T 2: 110,667,783 E738K probably damaging Het
Ano4 T A 10: 88,971,332 I796F probably damaging Het
Apeh T C 9: 108,092,591 E190G probably benign Het
Cadm3 A G 1: 173,338,055 L346P probably damaging Het
Clec2e G A 6: 129,094,425 H150Y possibly damaging Het
Cnga4 A T 7: 105,406,835 N318Y probably damaging Het
Cnr2 T A 4: 135,916,885 F91L probably damaging Het
Diaph3 T A 14: 86,656,399 E1147V probably damaging Het
Elmo2 T C 2: 165,291,855 T738A unknown Het
Exoc4 T A 6: 33,347,931 W387R probably damaging Het
Fam173b T C 15: 31,608,171 Y123H probably damaging Het
Focad T C 4: 88,397,000 V1379A unknown Het
Frmd4a T C 2: 4,603,702 S794P probably damaging Het
Ftl1-ps1 A G 13: 74,407,051 T150A probably benign Het
Gm5773 C T 3: 93,773,168 A49V probably benign Het
Helz T A 11: 107,686,421 L1867Q unknown Het
Il22ra1 A G 4: 135,734,278 H118R probably benign Het
Inf2 C T 12: 112,608,902 P856S unknown Het
Ints5 T A 19: 8,896,140 L488I probably damaging Het
Kifc1 G A 17: 33,883,203 R479C probably damaging Het
Lrba T A 3: 86,295,401 C289* probably null Het
Mael A G 1: 166,226,627 L196S probably damaging Het
Med23 T A 10: 24,879,683 S229R possibly damaging Het
Mroh9 T C 1: 163,039,233 N645D probably benign Het
Myom3 G A 4: 135,801,748 V1132I probably benign Het
Ndufa13 A T 8: 69,894,537 L71H probably damaging Het
Nepro A T 16: 44,731,415 H212L probably benign Het
Nox4 T A 7: 87,304,910 L141Q probably damaging Het
Olfr1254 T C 2: 89,789,046 E102G probably benign Het
Olfr283 T A 15: 98,378,997 M38L probably benign Het
Olfr473 T C 7: 107,934,438 V306A probably benign Het
Olfr482 T A 7: 108,095,289 T94S probably benign Het
Olfr811 T G 10: 129,801,943 E194A probably damaging Het
Pfpl A G 19: 12,430,206 D607G possibly damaging Het
Pkd1l2 A T 8: 117,076,182 F233L possibly damaging Het
Ptprz1 A T 6: 23,042,751 E2058V probably damaging Het
Rag1 A T 2: 101,642,507 N763K probably damaging Het
Rhbg A C 3: 88,248,453 D63E probably damaging Het
Rrm1 T A 7: 102,457,265 F330L probably benign Het
Scaf8 A T 17: 3,159,293 Q97L unknown Het
Slc18a1 A G 8: 69,075,147 V4A probably benign Het
Slirp T C 12: 87,447,600 V45A probably damaging Het
Spata31 A T 13: 64,922,804 Q922L probably benign Het
Spg11 A G 2: 122,097,321 S661P possibly damaging Het
Stab2 G T 10: 86,846,052 T2495K probably benign Het
Supt16 A G 14: 52,170,875 I871T probably damaging Het
Sval2 A G 6: 41,860,364 Q9R probably damaging Het
Syngap1 A T 17: 26,941,452 M1L probably benign Het
Tfpi A T 2: 84,453,922 M62K possibly damaging Het
Tm4sf1 A T 3: 57,287,765 Y200* probably null Het
Tmc1 A T 19: 20,900,817 W105R probably damaging Het
Tmtc2 T C 10: 105,190,126 E827G probably benign Het
Tollip T C 7: 141,892,826 I33V probably benign Het
Unc80 T A 1: 66,606,644 V1493D possibly damaging Het
Vmn2r6 G A 3: 64,559,824 R85W probably benign Het
Vwa5a C A 9: 38,736,020 S565* probably null Het
Xbp1 T A 11: 5,521,910 V12D probably benign Het
Other mutations in Sdr9c7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Sdr9c7 APN 10 127909828 missense probably damaging 1.00
IGL00857:Sdr9c7 APN 10 127898859 missense probably benign
IGL02280:Sdr9c7 APN 10 127902418 splice site probably benign
IGL02668:Sdr9c7 APN 10 127902398 missense probably damaging 0.99
R0047:Sdr9c7 UTSW 10 127903672 missense probably benign
R0047:Sdr9c7 UTSW 10 127903672 missense probably benign
R0325:Sdr9c7 UTSW 10 127898719 missense probably benign 0.00
R0440:Sdr9c7 UTSW 10 127898953 splice site probably benign
R1720:Sdr9c7 UTSW 10 127902258 missense probably damaging 1.00
R1936:Sdr9c7 UTSW 10 127903634 missense probably benign
R4790:Sdr9c7 UTSW 10 127903579 missense possibly damaging 0.77
R5145:Sdr9c7 UTSW 10 127902390 missense probably damaging 1.00
R5241:Sdr9c7 UTSW 10 127909790 missense probably benign 0.43
R6381:Sdr9c7 UTSW 10 127903673 missense probably benign 0.25
Z1176:Sdr9c7 UTSW 10 127902381 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGACTTTGCTTTTATGTACCG -3'
(R):5'- ATCCCCATTTGGACATCAGGG -3'

Sequencing Primer
(F):5'- GTACCGCTGGTTCAAAAATTGC -3'
(R):5'- ATTTGGACATCAGGGTCTCACAC -3'
Posted On2020-01-23