Incidental Mutation 'R8024:Xbp1'
ID617599
Institutional Source Beutler Lab
Gene Symbol Xbp1
Ensembl Gene ENSMUSG00000020484
Gene NameX-box binding protein 1
SynonymsXBP-1, D11Ertd39e, TREB-5, TREB5
Accession Numbers

Genbank: NM_013842; MGI: 98970; Ensembl: ENSMUST00000109866

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8024 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location5520659-5525893 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5521910 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 12 (V12D)
Ref Sequence ENSEMBL: ENSMUSP00000135768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063084] [ENSMUST00000149623]
Predicted Effect probably benign
Transcript: ENSMUST00000063084
SMART Domains Protein: ENSMUSP00000054852
Gene: ENSMUSG00000020484

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
BRLZ 61 125 9.12e-18 SMART
low complexity region 185 198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149159
SMART Domains Protein: ENSMUSP00000134088
Gene: ENSMUSG00000020484

DomainStartEndE-ValueType
BRLZ 2 57 2.62e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149623
AA Change: V12D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135768
Gene: ENSMUSG00000020484
AA Change: V12D

DomainStartEndE-ValueType
BRLZ 11 72 3.68e-13 SMART
low complexity region 132 145 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that regulates MHC class II genes by binding to a promoter element referred to as an X box. This gene product is a bZIP protein, which was also identified as a cellular transcription factor that binds to an enhancer in the promoter of the T cell leukemia virus type 1 promoter. It may increase expression of viral proteins by acting as the DNA binding partner of a viral transactivator. It has been found that upon accumulation of unfolded proteins in the endoplasmic reticulum (ER), the mRNA of this gene is processed to an active form by an unconventional splicing mechanism that is mediated by the endonuclease inositol-requiring enzyme 1 (IRE1). The resulting loss of 26 nt from the spliced mRNA causes a frame-shift and an isoform XBP1(S), which is the functionally active transcription factor. The isoform encoded by the unspliced mRNA, XBP1(U), is constitutively expressed, and thought to function as a negative feedback regulator of XBP1(S), which shuts off transcription of target genes during the recovery phase of ER stress. A pseudogene of XBP1 has been identified and localized to chromosome 5. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit markedly impaired liver development resulting in severe anemia, necrosis of cardiac myocytes, morphological abnormalities of the neural tube, and fetal death around embryonic day 14. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, knock-out(3) Targeted, other(6) Gene trapped(7)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,612,594 N1257Y probably benign Het
2310057J18Rik A T 10: 28,982,595 Y133* probably null Het
2310057J18Rik A C 10: 28,986,217 S26A possibly damaging Het
4931409K22Rik A G 5: 24,550,636 M296T possibly damaging Het
9930012K11Rik G T 14: 70,156,667 P220T probably damaging Het
A430105I19Rik A G 2: 118,760,524 probably null Het
Adam1b A C 5: 121,500,923 S686R probably benign Het
Adam8 T C 7: 139,987,576 D418G probably damaging Het
Adcy8 A G 15: 64,920,246 L287P probably damaging Het
Adhfe1 T A 1: 9,563,855 M373K probably benign Het
Alpk2 T C 18: 65,305,035 S1096G probably benign Het
Ankmy1 A G 1: 92,884,994 V531A probably benign Het
Ano3 C T 2: 110,667,783 E738K probably damaging Het
Ano4 T A 10: 88,971,332 I796F probably damaging Het
Apeh T C 9: 108,092,591 E190G probably benign Het
Cadm3 A G 1: 173,338,055 L346P probably damaging Het
Clec2e G A 6: 129,094,425 H150Y possibly damaging Het
Cnga4 A T 7: 105,406,835 N318Y probably damaging Het
Cnr2 T A 4: 135,916,885 F91L probably damaging Het
Diaph3 T A 14: 86,656,399 E1147V probably damaging Het
Elmo2 T C 2: 165,291,855 T738A unknown Het
Exoc4 T A 6: 33,347,931 W387R probably damaging Het
Fam173b T C 15: 31,608,171 Y123H probably damaging Het
Focad T C 4: 88,397,000 V1379A unknown Het
Frmd4a T C 2: 4,603,702 S794P probably damaging Het
Ftl1-ps1 A G 13: 74,407,051 T150A probably benign Het
Gm5773 C T 3: 93,773,168 A49V probably benign Het
Helz T A 11: 107,686,421 L1867Q unknown Het
Il22ra1 A G 4: 135,734,278 H118R probably benign Het
Inf2 C T 12: 112,608,902 P856S unknown Het
Ints5 T A 19: 8,896,140 L488I probably damaging Het
Kifc1 G A 17: 33,883,203 R479C probably damaging Het
Lrba T A 3: 86,295,401 C289* probably null Het
Mael A G 1: 166,226,627 L196S probably damaging Het
Med23 T A 10: 24,879,683 S229R possibly damaging Het
Mroh9 T C 1: 163,039,233 N645D probably benign Het
Myom3 G A 4: 135,801,748 V1132I probably benign Het
Ndufa13 A T 8: 69,894,537 L71H probably damaging Het
Nepro A T 16: 44,731,415 H212L probably benign Het
Nox4 T A 7: 87,304,910 L141Q probably damaging Het
Olfr1254 T C 2: 89,789,046 E102G probably benign Het
Olfr283 T A 15: 98,378,997 M38L probably benign Het
Olfr473 T C 7: 107,934,438 V306A probably benign Het
Olfr482 T A 7: 108,095,289 T94S probably benign Het
Olfr811 T G 10: 129,801,943 E194A probably damaging Het
Pfpl A G 19: 12,430,206 D607G possibly damaging Het
Pkd1l2 A T 8: 117,076,182 F233L possibly damaging Het
Ptprz1 A T 6: 23,042,751 E2058V probably damaging Het
Rag1 A T 2: 101,642,507 N763K probably damaging Het
Rhbg A C 3: 88,248,453 D63E probably damaging Het
Rrm1 T A 7: 102,457,265 F330L probably benign Het
Scaf8 A T 17: 3,159,293 Q97L unknown Het
Sdr9c7 G A 10: 127,898,882 V80I probably benign Het
Slc18a1 A G 8: 69,075,147 V4A probably benign Het
Slirp T C 12: 87,447,600 V45A probably damaging Het
Spata31 A T 13: 64,922,804 Q922L probably benign Het
Spg11 A G 2: 122,097,321 S661P possibly damaging Het
Stab2 G T 10: 86,846,052 T2495K probably benign Het
Supt16 A G 14: 52,170,875 I871T probably damaging Het
Sval2 A G 6: 41,860,364 Q9R probably damaging Het
Syngap1 A T 17: 26,941,452 M1L probably benign Het
Tfpi A T 2: 84,453,922 M62K possibly damaging Het
Tm4sf1 A T 3: 57,287,765 Y200* probably null Het
Tmc1 A T 19: 20,900,817 W105R probably damaging Het
Tmtc2 T C 10: 105,190,126 E827G probably benign Het
Tollip T C 7: 141,892,826 I33V probably benign Het
Unc80 T A 1: 66,606,644 V1493D possibly damaging Het
Vmn2r6 G A 3: 64,559,824 R85W probably benign Het
Vwa5a C A 9: 38,736,020 S565* probably null Het
Other mutations in Xbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1601:Xbp1 UTSW 11 5521975 missense probably damaging 1.00
R2256:Xbp1 UTSW 11 5524841 missense probably damaging 1.00
R4647:Xbp1 UTSW 11 5522006 missense probably damaging 1.00
R4782:Xbp1 UTSW 11 5521167 missense probably damaging 1.00
R4964:Xbp1 UTSW 11 5521125 missense probably damaging 0.98
R5367:Xbp1 UTSW 11 5521910 missense probably benign
R5718:Xbp1 UTSW 11 5521903 missense probably benign 0.00
R5928:Xbp1 UTSW 11 5523514 intron probably benign
R6038:Xbp1 UTSW 11 5524798 missense probably benign 0.00
R6038:Xbp1 UTSW 11 5524798 missense probably benign 0.00
R6492:Xbp1 UTSW 11 5521005 missense probably benign
R6835:Xbp1 UTSW 11 5521809 start gained probably benign
R6955:Xbp1 UTSW 11 5522018 missense probably null 0.97
R7067:Xbp1 UTSW 11 5524275 missense probably damaging 1.00
R7483:Xbp1 UTSW 11 5521098 missense probably benign 0.02
R7502:Xbp1 UTSW 11 5524683 critical splice acceptor site probably null
R7819:Xbp1 UTSW 11 5524886 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCGGTGGTAAAATGAGATCCGG -3'
(R):5'- AAGCAGTTTAGGATGGGCCC -3'

Sequencing Primer
(F):5'- CAAGCAAGTCTTCAAGGCCTGTG -3'
(R):5'- CAGTTTAGGATGGGCCCTGATATG -3'
Posted On2020-01-23