Incidental Mutation 'R8024:Spata31'
ID617603
Institutional Source Beutler Lab
Gene Symbol Spata31
Ensembl Gene ENSMUSG00000056223
Gene Namespermatogenesis associated 31
Synonyms4930458L03Rik, Fam75a, Spata31a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R8024 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location64917406-64923194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64922804 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 922 (Q922L)
Ref Sequence ENSEMBL: ENSMUSP00000097025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070216] [ENSMUST00000221202]
Predicted Effect probably benign
Transcript: ENSMUST00000070216
AA Change: Q922L

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097025
Gene: ENSMUSG00000056223
AA Change: Q922L

DomainStartEndE-ValueType
low complexity region 35 45 N/A INTRINSIC
low complexity region 91 106 N/A INTRINSIC
Pfam:FAM75 149 431 1.7e-83 PFAM
Pfam:FAM75 426 462 4.5e-9 PFAM
low complexity region 478 491 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221202
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (74/74)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,612,594 N1257Y probably benign Het
2310057J18Rik A T 10: 28,982,595 Y133* probably null Het
2310057J18Rik A C 10: 28,986,217 S26A possibly damaging Het
4931409K22Rik A G 5: 24,550,636 M296T possibly damaging Het
9930012K11Rik G T 14: 70,156,667 P220T probably damaging Het
A430105I19Rik A G 2: 118,760,524 probably null Het
Adam1b A C 5: 121,500,923 S686R probably benign Het
Adam8 T C 7: 139,987,576 D418G probably damaging Het
Adcy8 A G 15: 64,920,246 L287P probably damaging Het
Adhfe1 T A 1: 9,563,855 M373K probably benign Het
Alpk2 T C 18: 65,305,035 S1096G probably benign Het
Ankmy1 A G 1: 92,884,994 V531A probably benign Het
Ano3 C T 2: 110,667,783 E738K probably damaging Het
Ano4 T A 10: 88,971,332 I796F probably damaging Het
Apeh T C 9: 108,092,591 E190G probably benign Het
Cadm3 A G 1: 173,338,055 L346P probably damaging Het
Clec2e G A 6: 129,094,425 H150Y possibly damaging Het
Cnga4 A T 7: 105,406,835 N318Y probably damaging Het
Cnr2 T A 4: 135,916,885 F91L probably damaging Het
Diaph3 T A 14: 86,656,399 E1147V probably damaging Het
Elmo2 T C 2: 165,291,855 T738A unknown Het
Exoc4 T A 6: 33,347,931 W387R probably damaging Het
Fam173b T C 15: 31,608,171 Y123H probably damaging Het
Focad T C 4: 88,397,000 V1379A unknown Het
Frmd4a T C 2: 4,603,702 S794P probably damaging Het
Ftl1-ps1 A G 13: 74,407,051 T150A probably benign Het
Gm43517 A T 12: 49,389,626 probably benign Het
Gm5773 C T 3: 93,773,168 A49V probably benign Het
Helz T A 11: 107,686,421 L1867Q unknown Het
Il22ra1 A G 4: 135,734,278 H118R probably benign Het
Inf2 C T 12: 112,608,902 P856S unknown Het
Ints5 T A 19: 8,896,140 L488I probably damaging Het
Kifc1 G A 17: 33,883,203 R479C probably damaging Het
Lrba T A 3: 86,295,401 C289* probably null Het
Mael A G 1: 166,226,627 L196S probably damaging Het
Med23 T A 10: 24,879,683 S229R possibly damaging Het
Mroh9 T C 1: 163,039,233 N645D probably benign Het
Myom3 G A 4: 135,801,748 V1132I probably benign Het
Naalad2 T G 9: 18,397,473 probably benign Het
Ndufa13 A T 8: 69,894,537 L71H probably damaging Het
Nepro A T 16: 44,731,415 H212L probably benign Het
Nmd3 T A 3: 69,729,965 probably benign Het
Nox4 T A 7: 87,304,910 L141Q probably damaging Het
Olfr1254 T C 2: 89,789,046 E102G probably benign Het
Olfr283 T A 15: 98,378,997 M38L probably benign Het
Olfr473 T C 7: 107,934,438 V306A probably benign Het
Olfr482 T A 7: 108,095,289 T94S probably benign Het
Olfr811 T G 10: 129,801,943 E194A probably damaging Het
Pfpl A G 19: 12,430,206 D607G possibly damaging Het
Pkd1l2 A T 8: 117,076,182 F233L possibly damaging Het
Prl6a1 A G 13: 27,318,695 probably benign Het
Ptprz1 A T 6: 23,042,751 E2058V probably damaging Het
Rag1 A T 2: 101,642,507 N763K probably damaging Het
Rhbg A C 3: 88,248,453 D63E probably damaging Het
Rrm1 T A 7: 102,457,265 F330L probably benign Het
Scaf8 A T 17: 3,159,293 Q97L unknown Het
Sdr9c7 G A 10: 127,898,882 V80I probably benign Het
Slc18a1 A G 8: 69,075,147 V4A probably benign Het
Slco3a1 T A 7: 74,554,470 I41F probably benign Het
Slirp T C 12: 87,447,600 V45A probably damaging Het
Spg11 A G 2: 122,097,321 S661P possibly damaging Het
Stab2 G T 10: 86,846,052 T2495K probably benign Het
Supt16 A G 14: 52,170,875 I871T probably damaging Het
Sval2 A G 6: 41,860,364 Q9R probably damaging Het
Syngap1 A T 17: 26,941,452 M1L probably benign Het
Tfpi A T 2: 84,453,922 M62K possibly damaging Het
Tm4sf1 A T 3: 57,287,765 Y200* probably null Het
Tmc1 A T 19: 20,900,817 W105R probably damaging Het
Tmtc2 T C 10: 105,190,126 E827G probably benign Het
Tollip T C 7: 141,892,826 I33V probably benign Het
Unc80 T A 1: 66,606,644 V1493D possibly damaging Het
Vmn2r6 G A 3: 64,559,824 R85W probably benign Het
Vwa5a C A 9: 38,736,020 S565* probably null Het
Xbp1 T A 11: 5,521,910 V12D probably benign Het
Other mutations in Spata31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Spata31 APN 13 64922788 nonsense probably null
IGL01143:Spata31 APN 13 64920816 nonsense probably null
IGL01321:Spata31 APN 13 64921754 missense probably benign 0.01
IGL01624:Spata31 APN 13 64921585 missense probably damaging 1.00
IGL01844:Spata31 APN 13 64921154 missense possibly damaging 0.49
IGL02259:Spata31 APN 13 64921483 missense possibly damaging 0.90
IGL02358:Spata31 APN 13 64921218 missense probably benign
IGL02377:Spata31 APN 13 64920380 missense probably damaging 0.98
IGL02723:Spata31 APN 13 64920649 missense probably benign 0.10
IGL03125:Spata31 APN 13 64920889 missense probably benign 0.09
IGL03343:Spata31 APN 13 64919773 missense probably benign 0.41
BB006:Spata31 UTSW 13 64921718 missense probably benign 0.04
BB016:Spata31 UTSW 13 64921718 missense probably benign 0.04
F5770:Spata31 UTSW 13 64921648 missense probably benign 0.18
IGL02991:Spata31 UTSW 13 64920719 missense probably benign 0.05
P0043:Spata31 UTSW 13 64921006 splice site probably null
PIT4366001:Spata31 UTSW 13 64921505 nonsense probably null
PIT4458001:Spata31 UTSW 13 64921850 missense probably benign 0.01
PIT4687001:Spata31 UTSW 13 64921337 missense probably benign 0.02
R0042:Spata31 UTSW 13 64922563 missense probably benign 0.00
R0042:Spata31 UTSW 13 64922563 missense probably benign 0.00
R0064:Spata31 UTSW 13 64922098 missense probably damaging 0.98
R0064:Spata31 UTSW 13 64922098 missense probably damaging 0.98
R0639:Spata31 UTSW 13 64922213 missense probably benign 0.02
R1253:Spata31 UTSW 13 64922024 missense probably benign 0.23
R1536:Spata31 UTSW 13 64921382 missense probably damaging 1.00
R1656:Spata31 UTSW 13 64921139 missense probably benign
R1802:Spata31 UTSW 13 64922383 missense probably benign 0.01
R1813:Spata31 UTSW 13 64921798 missense probably benign 0.32
R1916:Spata31 UTSW 13 64922545 nonsense probably null
R1917:Spata31 UTSW 13 64920865 missense possibly damaging 0.92
R1933:Spata31 UTSW 13 64920610 missense probably benign 0.02
R2910:Spata31 UTSW 13 64920436 missense probably benign 0.12
R3750:Spata31 UTSW 13 64921743 missense probably benign 0.01
R3876:Spata31 UTSW 13 64920931 missense probably benign 0.03
R3980:Spata31 UTSW 13 64922654 missense probably benign 0.24
R4056:Spata31 UTSW 13 64921655 missense probably benign 0.00
R4300:Spata31 UTSW 13 64919761 missense probably benign 0.08
R4797:Spata31 UTSW 13 64922742 nonsense probably null
R4997:Spata31 UTSW 13 64919723 missense probably benign 0.00
R5185:Spata31 UTSW 13 64917526 missense possibly damaging 0.93
R5366:Spata31 UTSW 13 64920459 missense probably damaging 0.98
R5539:Spata31 UTSW 13 64922969 missense probably benign 0.00
R5704:Spata31 UTSW 13 64922041 missense probably benign 0.32
R5748:Spata31 UTSW 13 64920313 makesense probably null
R5834:Spata31 UTSW 13 64922666 missense probably benign 0.19
R5926:Spata31 UTSW 13 64920725 missense possibly damaging 0.82
R6476:Spata31 UTSW 13 64917642 missense possibly damaging 0.68
R6603:Spata31 UTSW 13 64922665 missense probably damaging 1.00
R6620:Spata31 UTSW 13 64919757 missense possibly damaging 0.68
R6965:Spata31 UTSW 13 64922834 missense possibly damaging 0.90
R7086:Spata31 UTSW 13 64922229 missense probably benign 0.02
R7140:Spata31 UTSW 13 64921099 missense probably benign
R7396:Spata31 UTSW 13 64920733 missense probably benign
R7545:Spata31 UTSW 13 64922545 nonsense probably null
R7575:Spata31 UTSW 13 64922912 missense unknown
R7607:Spata31 UTSW 13 64921592 missense probably damaging 1.00
R7929:Spata31 UTSW 13 64921718 missense probably benign 0.04
R8088:Spata31 UTSW 13 64920865 missense probably benign 0.31
R8323:Spata31 UTSW 13 64922251 missense possibly damaging 0.61
R8362:Spata31 UTSW 13 64922230 missense possibly damaging 0.58
R8870:Spata31 UTSW 13 64921004 missense probably benign
V7580:Spata31 UTSW 13 64921648 missense probably benign 0.18
V7581:Spata31 UTSW 13 64921648 missense probably benign 0.18
V7583:Spata31 UTSW 13 64921648 missense probably benign 0.18
Z1176:Spata31 UTSW 13 64921972 nonsense probably null
Z1177:Spata31 UTSW 13 64921972 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCCCAGGAACTTATGACAAC -3'
(R):5'- GGTGATTTGAATTTCCTGGCAC -3'

Sequencing Primer
(F):5'- CCCAGGAACTTATGACAACTGTTGG -3'
(R):5'- GCACTATTGTTCTGTTCTGAGAATTC -3'
Posted On2020-01-23