Incidental Mutation 'R8024:Supt16'
ID 617606
Institutional Source Beutler Lab
Gene Symbol Supt16
Ensembl Gene ENSMUSG00000035726
Gene Name SPT16, facilitates chromatin remodeling subunit
Synonyms Spt16, Fact140, Supt16h, Cdc68
MMRRC Submission 067463-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.966) question?
Stock # R8024 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 52397876-52434696 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 52408332 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 871 (I871T)
Ref Sequence ENSEMBL: ENSMUSP00000042283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046709]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000046709
AA Change: I871T

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000042283
Gene: ENSMUSG00000035726
AA Change: I871T

DomainStartEndE-ValueType
FACT-Spt16_Nlob 5 168 2.95e-87 SMART
Pfam:Peptidase_M24 181 411 2.9e-35 PFAM
low complexity region 435 449 N/A INTRINSIC
coiled coil region 462 493 N/A INTRINSIC
SPT16 529 689 3.38e-96 SMART
Rtt106 806 896 1.61e-38 SMART
low complexity region 926 946 N/A INTRINSIC
low complexity region 951 988 N/A INTRINSIC
coiled coil region 994 1023 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription of protein-coding genes can be reconstituted on naked DNA with only the general transcription factors and RNA polymerase II. However, this minimal system cannot transcribe DNA packaged into chromatin, indicating that accessory factors may facilitate access to DNA. One such factor, FACT (facilitates chromatin transcription), interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT is composed of an 80 kDa subunit and a 140 kDa subunit; this gene encodes the 140 kDa subunit. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,760,713 (GRCm39) N1257Y probably benign Het
2310057J18Rik A T 10: 28,858,591 (GRCm39) Y133* probably null Het
2310057J18Rik A C 10: 28,862,213 (GRCm39) S26A possibly damaging Het
9930012K11Rik G T 14: 70,394,116 (GRCm39) P220T probably damaging Het
Adam1b A C 5: 121,638,986 (GRCm39) S686R probably benign Het
Adam8 T C 7: 139,567,489 (GRCm39) D418G probably damaging Het
Adcy8 A G 15: 64,792,095 (GRCm39) L287P probably damaging Het
Adhfe1 T A 1: 9,634,080 (GRCm39) M373K probably benign Het
Alpk2 T C 18: 65,438,106 (GRCm39) S1096G probably benign Het
Ankmy1 A G 1: 92,812,716 (GRCm39) V531A probably benign Het
Ano3 C T 2: 110,498,128 (GRCm39) E738K probably damaging Het
Ano4 T A 10: 88,807,194 (GRCm39) I796F probably damaging Het
Apeh T C 9: 107,969,790 (GRCm39) E190G probably benign Het
Atpsckmt T C 15: 31,608,317 (GRCm39) Y123H probably damaging Het
Cadm3 A G 1: 173,165,622 (GRCm39) L346P probably damaging Het
Ccdc9b A G 2: 118,591,005 (GRCm39) probably null Het
Clec2e G A 6: 129,071,388 (GRCm39) H150Y possibly damaging Het
Cnga4 A T 7: 105,056,042 (GRCm39) N318Y probably damaging Het
Cnr2 T A 4: 135,644,196 (GRCm39) F91L probably damaging Het
Diaph3 T A 14: 86,893,835 (GRCm39) E1147V probably damaging Het
Elmo2 T C 2: 165,133,775 (GRCm39) T738A unknown Het
Exoc4 T A 6: 33,324,866 (GRCm39) W387R probably damaging Het
Focad T C 4: 88,315,237 (GRCm39) V1379A unknown Het
Frmd4a T C 2: 4,608,513 (GRCm39) S794P probably damaging Het
Ftl1-ps1 A G 13: 74,555,170 (GRCm39) T150A probably benign Het
Gm43517 A T 12: 49,436,409 (GRCm39) probably benign Het
Gm5773 C T 3: 93,680,475 (GRCm39) A49V probably benign Het
Helz T A 11: 107,577,247 (GRCm39) L1867Q unknown Het
Il22ra1 A G 4: 135,461,589 (GRCm39) H118R probably benign Het
Inf2 C T 12: 112,575,336 (GRCm39) P856S unknown Het
Ints5 T A 19: 8,873,504 (GRCm39) L488I probably damaging Het
Iqca1l A G 5: 24,755,634 (GRCm39) M296T possibly damaging Het
Kifc1 G A 17: 34,102,177 (GRCm39) R479C probably damaging Het
Lrba T A 3: 86,202,708 (GRCm39) C289* probably null Het
Mael A G 1: 166,054,196 (GRCm39) L196S probably damaging Het
Med23 T A 10: 24,755,581 (GRCm39) S229R possibly damaging Het
Mroh9 T C 1: 162,866,802 (GRCm39) N645D probably benign Het
Myom3 G A 4: 135,529,059 (GRCm39) V1132I probably benign Het
Naalad2 T G 9: 18,308,769 (GRCm39) probably benign Het
Ndufa13 A T 8: 70,347,187 (GRCm39) L71H probably damaging Het
Nepro A T 16: 44,551,778 (GRCm39) H212L probably benign Het
Nmd3 T A 3: 69,637,298 (GRCm39) probably benign Het
Nox4 T A 7: 86,954,118 (GRCm39) L141Q probably damaging Het
Or4a81 T C 2: 89,619,390 (GRCm39) E102G probably benign Het
Or5p53 T C 7: 107,533,645 (GRCm39) V306A probably benign Het
Or5p58 T A 7: 107,694,496 (GRCm39) T94S probably benign Het
Or6c215 T G 10: 129,637,812 (GRCm39) E194A probably damaging Het
Or8s2 T A 15: 98,276,878 (GRCm39) M38L probably benign Het
Pfpl A G 19: 12,407,570 (GRCm39) D607G possibly damaging Het
Pkd1l2 A T 8: 117,802,921 (GRCm39) F233L possibly damaging Het
Prl6a1 A G 13: 27,502,678 (GRCm39) probably benign Het
Ptprz1 A T 6: 23,042,750 (GRCm39) E2058V probably damaging Het
Rag1 A T 2: 101,472,852 (GRCm39) N763K probably damaging Het
Rhbg A C 3: 88,155,760 (GRCm39) D63E probably damaging Het
Rrm1 T A 7: 102,106,472 (GRCm39) F330L probably benign Het
Scaf8 A T 17: 3,209,568 (GRCm39) Q97L unknown Het
Sdr9c7 G A 10: 127,734,751 (GRCm39) V80I probably benign Het
Slc18a1 A G 8: 69,527,799 (GRCm39) V4A probably benign Het
Slco3a1 T A 7: 74,204,218 (GRCm39) I41F probably benign Het
Slirp T C 12: 87,494,370 (GRCm39) V45A probably damaging Het
Spata31 A T 13: 65,070,618 (GRCm39) Q922L probably benign Het
Spg11 A G 2: 121,927,802 (GRCm39) S661P possibly damaging Het
Stab2 G T 10: 86,681,916 (GRCm39) T2495K probably benign Het
Sval2 A G 6: 41,837,298 (GRCm39) Q9R probably damaging Het
Syngap1 A T 17: 27,160,426 (GRCm39) M1L probably benign Het
Tfpi A T 2: 84,284,266 (GRCm39) M62K possibly damaging Het
Tm4sf1 A T 3: 57,195,186 (GRCm39) Y200* probably null Het
Tmc1 A T 19: 20,878,181 (GRCm39) W105R probably damaging Het
Tmtc2 T C 10: 105,025,987 (GRCm39) E827G probably benign Het
Tollip T C 7: 141,446,563 (GRCm39) I33V probably benign Het
Unc80 T A 1: 66,645,803 (GRCm39) V1493D possibly damaging Het
Vmn2r6 G A 3: 64,467,245 (GRCm39) R85W probably benign Het
Vwa5a C A 9: 38,647,316 (GRCm39) S565* probably null Het
Xbp1 T A 11: 5,471,910 (GRCm39) V12D probably benign Het
Other mutations in Supt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Supt16 APN 14 52,399,255 (GRCm39) missense possibly damaging 0.72
IGL00985:Supt16 APN 14 52,399,148 (GRCm39) missense possibly damaging 0.53
IGL01160:Supt16 APN 14 52,420,589 (GRCm39) missense probably benign
IGL01328:Supt16 APN 14 52,414,489 (GRCm39) missense probably benign 0.20
IGL01329:Supt16 APN 14 52,414,489 (GRCm39) missense probably benign 0.20
IGL01413:Supt16 APN 14 52,414,489 (GRCm39) missense probably benign 0.20
IGL01414:Supt16 APN 14 52,414,489 (GRCm39) missense probably benign 0.20
IGL01535:Supt16 APN 14 52,414,647 (GRCm39) missense probably damaging 0.99
IGL01765:Supt16 APN 14 52,417,680 (GRCm39) missense probably damaging 0.98
IGL01976:Supt16 APN 14 52,419,764 (GRCm39) missense possibly damaging 0.70
IGL02422:Supt16 APN 14 52,417,000 (GRCm39) missense possibly damaging 0.85
IGL02449:Supt16 APN 14 52,411,263 (GRCm39) missense possibly damaging 0.92
IGL02516:Supt16 APN 14 52,421,421 (GRCm39) missense possibly damaging 0.57
IGL02831:Supt16 APN 14 52,408,335 (GRCm39) missense possibly damaging 0.70
IGL03112:Supt16 APN 14 52,413,855 (GRCm39) missense probably damaging 0.98
IGL03406:Supt16 APN 14 52,415,598 (GRCm39) missense possibly damaging 0.92
R7336_Supt16_529 UTSW 14 52,408,948 (GRCm39) missense possibly damaging 0.93
watercolor UTSW 14 52,408,338 (GRCm39) missense probably damaging 0.96
R0332:Supt16 UTSW 14 52,418,614 (GRCm39) missense probably damaging 0.99
R0385:Supt16 UTSW 14 52,414,175 (GRCm39) missense probably benign 0.01
R0389:Supt16 UTSW 14 52,411,570 (GRCm39) missense probably damaging 0.98
R0422:Supt16 UTSW 14 52,421,453 (GRCm39) missense probably benign 0.26
R1101:Supt16 UTSW 14 52,408,896 (GRCm39) missense probably null 0.81
R1212:Supt16 UTSW 14 52,411,581 (GRCm39) nonsense probably null
R1487:Supt16 UTSW 14 52,414,065 (GRCm39) critical splice donor site probably null
R1494:Supt16 UTSW 14 52,409,916 (GRCm39) missense probably benign 0.01
R1566:Supt16 UTSW 14 52,414,112 (GRCm39) missense probably damaging 0.99
R1652:Supt16 UTSW 14 52,414,637 (GRCm39) missense probably benign 0.34
R1913:Supt16 UTSW 14 52,415,592 (GRCm39) missense possibly damaging 0.84
R2220:Supt16 UTSW 14 52,409,601 (GRCm39) nonsense probably null
R2344:Supt16 UTSW 14 52,415,575 (GRCm39) missense probably benign 0.00
R3430:Supt16 UTSW 14 52,412,816 (GRCm39) missense probably benign 0.05
R3746:Supt16 UTSW 14 52,417,596 (GRCm39) missense probably damaging 0.99
R3749:Supt16 UTSW 14 52,417,596 (GRCm39) missense probably damaging 0.99
R4010:Supt16 UTSW 14 52,401,898 (GRCm39) missense probably damaging 1.00
R4108:Supt16 UTSW 14 52,400,188 (GRCm39) missense probably damaging 1.00
R4109:Supt16 UTSW 14 52,400,188 (GRCm39) missense probably damaging 1.00
R4597:Supt16 UTSW 14 52,411,046 (GRCm39) missense probably damaging 1.00
R5117:Supt16 UTSW 14 52,420,549 (GRCm39) missense probably damaging 1.00
R5309:Supt16 UTSW 14 52,400,155 (GRCm39) missense probably damaging 1.00
R5695:Supt16 UTSW 14 52,411,601 (GRCm39) splice site probably null
R5895:Supt16 UTSW 14 52,401,979 (GRCm39) missense probably benign 0.17
R5941:Supt16 UTSW 14 52,419,653 (GRCm39) missense probably benign
R5993:Supt16 UTSW 14 52,415,791 (GRCm39) missense probably damaging 1.00
R6197:Supt16 UTSW 14 52,408,338 (GRCm39) missense probably damaging 0.96
R6254:Supt16 UTSW 14 52,408,291 (GRCm39) missense probably damaging 1.00
R6381:Supt16 UTSW 14 52,417,003 (GRCm39) missense probably benign 0.02
R6667:Supt16 UTSW 14 52,409,520 (GRCm39) missense probably damaging 1.00
R7000:Supt16 UTSW 14 52,408,907 (GRCm39) missense probably damaging 0.97
R7063:Supt16 UTSW 14 52,409,505 (GRCm39) missense possibly damaging 0.92
R7276:Supt16 UTSW 14 52,414,458 (GRCm39) missense probably benign
R7336:Supt16 UTSW 14 52,408,948 (GRCm39) missense possibly damaging 0.93
R7344:Supt16 UTSW 14 52,411,028 (GRCm39) missense probably damaging 0.98
R7384:Supt16 UTSW 14 52,418,619 (GRCm39) missense probably damaging 0.99
R7411:Supt16 UTSW 14 52,415,508 (GRCm39) missense probably damaging 1.00
R7586:Supt16 UTSW 14 52,411,013 (GRCm39) missense probably damaging 0.97
R7633:Supt16 UTSW 14 52,434,556 (GRCm39) missense probably benign 0.38
R8197:Supt16 UTSW 14 52,411,542 (GRCm39) missense possibly damaging 0.95
R8201:Supt16 UTSW 14 52,408,447 (GRCm39) missense probably damaging 1.00
R8285:Supt16 UTSW 14 52,418,540 (GRCm39) missense possibly damaging 0.95
R8508:Supt16 UTSW 14 52,419,046 (GRCm39) missense probably damaging 1.00
R8531:Supt16 UTSW 14 52,410,020 (GRCm39) missense probably damaging 0.98
R8797:Supt16 UTSW 14 52,409,960 (GRCm39) missense probably damaging 0.99
R8872:Supt16 UTSW 14 52,411,544 (GRCm39) missense probably benign 0.01
R9048:Supt16 UTSW 14 52,418,513 (GRCm39) missense probably damaging 1.00
R9743:Supt16 UTSW 14 52,408,939 (GRCm39) missense probably damaging 1.00
Z1177:Supt16 UTSW 14 52,418,994 (GRCm39) missense probably null 0.21
Z1177:Supt16 UTSW 14 52,400,742 (GRCm39) missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GCAGAAGCCAACTGTTTAGG -3'
(R):5'- ATTGCAGGGAGGTGCTTACAC -3'

Sequencing Primer
(F):5'- CAGAAGCCAACTGTTTAGGAGAATG -3'
(R):5'- GCTTACACAGTAATGATGCGGCTC -3'
Posted On 2020-01-23