Incidental Mutation 'R8024:Nepro'
ID617612
Institutional Source Beutler Lab
Gene Symbol Nepro
Ensembl Gene ENSMUSG00000036208
Gene Namenucleolus and neural progenitor protein
SynonymsBC027231
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8024 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location44724301-44737284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44731415 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 212 (H212L)
Ref Sequence ENSEMBL: ENSMUSP00000038779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048788] [ENSMUST00000123673] [ENSMUST00000147804]
Predicted Effect probably benign
Transcript: ENSMUST00000048788
AA Change: H212L

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000038779
Gene: ENSMUSG00000036208
AA Change: H212L

DomainStartEndE-ValueType
Pfam:DUF4477 12 202 3.2e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123673
Predicted Effect probably benign
Transcript: ENSMUST00000132610
SMART Domains Protein: ENSMUSP00000116115
Gene: ENSMUSG00000036208

DomainStartEndE-ValueType
Pfam:DUF4477 1 118 7.5e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147804
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality prior to implantation with a failure to form a blastocyst. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,612,594 N1257Y probably benign Het
2310057J18Rik A T 10: 28,982,595 Y133* probably null Het
2310057J18Rik A C 10: 28,986,217 S26A possibly damaging Het
4931409K22Rik A G 5: 24,550,636 M296T possibly damaging Het
9930012K11Rik G T 14: 70,156,667 P220T probably damaging Het
A430105I19Rik A G 2: 118,760,524 probably null Het
Adam1b A C 5: 121,500,923 S686R probably benign Het
Adam8 T C 7: 139,987,576 D418G probably damaging Het
Adcy8 A G 15: 64,920,246 L287P probably damaging Het
Adhfe1 T A 1: 9,563,855 M373K probably benign Het
Alpk2 T C 18: 65,305,035 S1096G probably benign Het
Ankmy1 A G 1: 92,884,994 V531A probably benign Het
Ano3 C T 2: 110,667,783 E738K probably damaging Het
Ano4 T A 10: 88,971,332 I796F probably damaging Het
Apeh T C 9: 108,092,591 E190G probably benign Het
Cadm3 A G 1: 173,338,055 L346P probably damaging Het
Clec2e G A 6: 129,094,425 H150Y possibly damaging Het
Cnga4 A T 7: 105,406,835 N318Y probably damaging Het
Cnr2 T A 4: 135,916,885 F91L probably damaging Het
Diaph3 T A 14: 86,656,399 E1147V probably damaging Het
Elmo2 T C 2: 165,291,855 T738A unknown Het
Exoc4 T A 6: 33,347,931 W387R probably damaging Het
Fam173b T C 15: 31,608,171 Y123H probably damaging Het
Focad T C 4: 88,397,000 V1379A unknown Het
Frmd4a T C 2: 4,603,702 S794P probably damaging Het
Ftl1-ps1 A G 13: 74,407,051 T150A probably benign Het
Gm5773 C T 3: 93,773,168 A49V probably benign Het
Helz T A 11: 107,686,421 L1867Q unknown Het
Il22ra1 A G 4: 135,734,278 H118R probably benign Het
Inf2 C T 12: 112,608,902 P856S unknown Het
Ints5 T A 19: 8,896,140 L488I probably damaging Het
Kifc1 G A 17: 33,883,203 R479C probably damaging Het
Lrba T A 3: 86,295,401 C289* probably null Het
Mael A G 1: 166,226,627 L196S probably damaging Het
Med23 T A 10: 24,879,683 S229R possibly damaging Het
Mroh9 T C 1: 163,039,233 N645D probably benign Het
Myom3 G A 4: 135,801,748 V1132I probably benign Het
Ndufa13 A T 8: 69,894,537 L71H probably damaging Het
Nox4 T A 7: 87,304,910 L141Q probably damaging Het
Olfr1254 T C 2: 89,789,046 E102G probably benign Het
Olfr283 T A 15: 98,378,997 M38L probably benign Het
Olfr473 T C 7: 107,934,438 V306A probably benign Het
Olfr482 T A 7: 108,095,289 T94S probably benign Het
Olfr811 T G 10: 129,801,943 E194A probably damaging Het
Pfpl A G 19: 12,430,206 D607G possibly damaging Het
Pkd1l2 A T 8: 117,076,182 F233L possibly damaging Het
Ptprz1 A T 6: 23,042,751 E2058V probably damaging Het
Rag1 A T 2: 101,642,507 N763K probably damaging Het
Rhbg A C 3: 88,248,453 D63E probably damaging Het
Rrm1 T A 7: 102,457,265 F330L probably benign Het
Scaf8 A T 17: 3,159,293 Q97L unknown Het
Sdr9c7 G A 10: 127,898,882 V80I probably benign Het
Slc18a1 A G 8: 69,075,147 V4A probably benign Het
Slirp T C 12: 87,447,600 V45A probably damaging Het
Spata31 A T 13: 64,922,804 Q922L probably benign Het
Spg11 A G 2: 122,097,321 S661P possibly damaging Het
Stab2 G T 10: 86,846,052 T2495K probably benign Het
Supt16 A G 14: 52,170,875 I871T probably damaging Het
Sval2 A G 6: 41,860,364 Q9R probably damaging Het
Syngap1 A T 17: 26,941,452 M1L probably benign Het
Tfpi A T 2: 84,453,922 M62K possibly damaging Het
Tm4sf1 A T 3: 57,287,765 Y200* probably null Het
Tmc1 A T 19: 20,900,817 W105R probably damaging Het
Tmtc2 T C 10: 105,190,126 E827G probably benign Het
Tollip T C 7: 141,892,826 I33V probably benign Het
Unc80 T A 1: 66,606,644 V1493D possibly damaging Het
Vmn2r6 G A 3: 64,559,824 R85W probably benign Het
Vwa5a C A 9: 38,736,020 S565* probably null Het
Xbp1 T A 11: 5,521,910 V12D probably benign Het
Other mutations in Nepro
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Nepro APN 16 44729305 nonsense probably null
IGL01688:Nepro APN 16 44736006 missense probably damaging 0.97
IGL03149:Nepro APN 16 44727099 missense probably damaging 1.00
IGL03046:Nepro UTSW 16 44732146 unclassified probably benign
R0839:Nepro UTSW 16 44736019 missense probably benign 0.27
R1619:Nepro UTSW 16 44727028 missense probably benign 0.01
R1777:Nepro UTSW 16 44735853 missense probably damaging 0.99
R4273:Nepro UTSW 16 44735829 missense possibly damaging 0.47
R4487:Nepro UTSW 16 44735726 missense probably damaging 1.00
R4750:Nepro UTSW 16 44730182 missense probably damaging 1.00
R4841:Nepro UTSW 16 44734797 missense probably null 1.00
R4842:Nepro UTSW 16 44734797 missense probably null 1.00
R4869:Nepro UTSW 16 44730173 missense probably damaging 1.00
R4973:Nepro UTSW 16 44734793 missense probably benign 0.16
R4988:Nepro UTSW 16 44734542 missense possibly damaging 0.95
R6480:Nepro UTSW 16 44727075 missense probably damaging 1.00
R6830:Nepro UTSW 16 44731357 missense probably damaging 1.00
R7149:Nepro UTSW 16 44729715 critical splice donor site probably null
U24488:Nepro UTSW 16 44734586 missense probably benign 0.02
X0067:Nepro UTSW 16 44734703 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- TGTAGCAAAACTGTCAAACAACA -3'
(R):5'- TCATTCATCTTTGGTAGCTGCT -3'

Sequencing Primer
(F):5'- GTTGCAGTAAGACTAGGTACCTCC -3'
(R):5'- GGTAGCTGCTCTCTCATTAAAAACAG -3'
Posted On2020-01-23