Incidental Mutation 'R8024:Syngap1'
ID617614
Institutional Source Beutler Lab
Gene Symbol Syngap1
Ensembl Gene ENSMUSG00000067629
Gene Namesynaptic Ras GTPase activating protein 1 homolog (rat)
SynonymsSyngap
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8024 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location26941253-26972434 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 26941452 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000141686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025027] [ENSMUST00000073724] [ENSMUST00000114935] [ENSMUST00000177932] [ENSMUST00000194598] [ENSMUST00000201702] [ENSMUST00000229490]
Predicted Effect probably benign
Transcript: ENSMUST00000025027
SMART Domains Protein: ENSMUSP00000025027
Gene: ENSMUSG00000024194

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 45 60 N/A INTRINSIC
Pfam:CutA1 67 165 6.9e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073724
SMART Domains Protein: ENSMUSP00000073402
Gene: ENSMUSG00000024193

DomainStartEndE-ValueType
TUDOR 29 86 5.61e-11 SMART
PHD 89 140 2.81e-8 SMART
PHD 188 238 2.42e0 SMART
low complexity region 410 416 N/A INTRINSIC
low complexity region 481 495 N/A INTRINSIC
Pfam:Mtf2_C 523 557 7.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114935
SMART Domains Protein: ENSMUSP00000110585
Gene: ENSMUSG00000024194

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:CutA1 43 144 1.7e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177932
AA Change: M1L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000137587
Gene: ENSMUSG00000067629
AA Change: M1L

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193200
SMART Domains Protein: ENSMUSP00000141245
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 12 238 1.5e-10 SMART
C2 248 347 4.8e-12 SMART
RasGAP 377 714 2.1e-120 SMART
low complexity region 772 788 N/A INTRINSIC
low complexity region 923 958 N/A INTRINSIC
low complexity region 1025 1053 N/A INTRINSIC
low complexity region 1095 1110 N/A INTRINSIC
coiled coil region 1171 1244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194598
AA Change: M1L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000141686
Gene: ENSMUSG00000067629
AA Change: M1L

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
low complexity region 1308 1326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201349
SMART Domains Protein: ENSMUSP00000144666
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
RasGAP 9 346 2.2e-120 SMART
low complexity region 404 420 N/A INTRINSIC
low complexity region 555 590 N/A INTRINSIC
low complexity region 657 685 N/A INTRINSIC
low complexity region 727 742 N/A INTRINSIC
Blast:RasGAP 761 876 3e-21 BLAST
low complexity region 884 894 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000144248
Gene: ENSMUSG00000067629
AA Change: M1L

DomainStartEndE-ValueType
PH 27 253 1.5e-10 SMART
C2 263 362 4.9e-12 SMART
RasGAP 392 729 2.2e-120 SMART
low complexity region 773 789 N/A INTRINSIC
low complexity region 924 959 N/A INTRINSIC
low complexity region 1026 1054 N/A INTRINSIC
low complexity region 1096 1111 N/A INTRINSIC
coiled coil region 1171 1243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229490
AA Change: M1L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a Ras GTPase activating protein that is a member of the N-methyl-D-aspartate receptor complex. The N-terminal domain of the protein contains a Ras-GAP domain, a pleckstrin homology domain, and a C2 domain that may be involved in binding of calcium and phospholipids. The C-terminal domain consists of a ten histidine repeat region, serine and tyrosine phosphorylation sites, and a T/SXV motif required for postsynaptic scaffold protein interaction. The encoded protein negatively regulates Ras, Rap and alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor trafficking to the postsynaptic membrane to regulate synaptic plasticity and neuronal homeostasis. Homozygous null mutations result in early post-embryonic lethality, while heterozygous mutant mice display a variety of phenotypes that include learning and memory defects, hyperactivity, and audiogenic seizures. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mutant mice exhibit postnatal lethality, and by P3-P4, exhibit small body size and brain, reduced movement and do not feed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,612,594 N1257Y probably benign Het
2310057J18Rik A T 10: 28,982,595 Y133* probably null Het
2310057J18Rik A C 10: 28,986,217 S26A possibly damaging Het
4931409K22Rik A G 5: 24,550,636 M296T possibly damaging Het
9930012K11Rik G T 14: 70,156,667 P220T probably damaging Het
A430105I19Rik A G 2: 118,760,524 probably null Het
Adam1b A C 5: 121,500,923 S686R probably benign Het
Adam8 T C 7: 139,987,576 D418G probably damaging Het
Adcy8 A G 15: 64,920,246 L287P probably damaging Het
Adhfe1 T A 1: 9,563,855 M373K probably benign Het
Alpk2 T C 18: 65,305,035 S1096G probably benign Het
Ankmy1 A G 1: 92,884,994 V531A probably benign Het
Ano3 C T 2: 110,667,783 E738K probably damaging Het
Ano4 T A 10: 88,971,332 I796F probably damaging Het
Apeh T C 9: 108,092,591 E190G probably benign Het
Cadm3 A G 1: 173,338,055 L346P probably damaging Het
Clec2e G A 6: 129,094,425 H150Y possibly damaging Het
Cnga4 A T 7: 105,406,835 N318Y probably damaging Het
Cnr2 T A 4: 135,916,885 F91L probably damaging Het
Diaph3 T A 14: 86,656,399 E1147V probably damaging Het
Elmo2 T C 2: 165,291,855 T738A unknown Het
Exoc4 T A 6: 33,347,931 W387R probably damaging Het
Fam173b T C 15: 31,608,171 Y123H probably damaging Het
Focad T C 4: 88,397,000 V1379A unknown Het
Frmd4a T C 2: 4,603,702 S794P probably damaging Het
Ftl1-ps1 A G 13: 74,407,051 T150A probably benign Het
Gm5773 C T 3: 93,773,168 A49V probably benign Het
Helz T A 11: 107,686,421 L1867Q unknown Het
Il22ra1 A G 4: 135,734,278 H118R probably benign Het
Inf2 C T 12: 112,608,902 P856S unknown Het
Ints5 T A 19: 8,896,140 L488I probably damaging Het
Kifc1 G A 17: 33,883,203 R479C probably damaging Het
Lrba T A 3: 86,295,401 C289* probably null Het
Mael A G 1: 166,226,627 L196S probably damaging Het
Med23 T A 10: 24,879,683 S229R possibly damaging Het
Mroh9 T C 1: 163,039,233 N645D probably benign Het
Myom3 G A 4: 135,801,748 V1132I probably benign Het
Ndufa13 A T 8: 69,894,537 L71H probably damaging Het
Nepro A T 16: 44,731,415 H212L probably benign Het
Nox4 T A 7: 87,304,910 L141Q probably damaging Het
Olfr1254 T C 2: 89,789,046 E102G probably benign Het
Olfr283 T A 15: 98,378,997 M38L probably benign Het
Olfr473 T C 7: 107,934,438 V306A probably benign Het
Olfr482 T A 7: 108,095,289 T94S probably benign Het
Olfr811 T G 10: 129,801,943 E194A probably damaging Het
Pfpl A G 19: 12,430,206 D607G possibly damaging Het
Pkd1l2 A T 8: 117,076,182 F233L possibly damaging Het
Ptprz1 A T 6: 23,042,751 E2058V probably damaging Het
Rag1 A T 2: 101,642,507 N763K probably damaging Het
Rhbg A C 3: 88,248,453 D63E probably damaging Het
Rrm1 T A 7: 102,457,265 F330L probably benign Het
Scaf8 A T 17: 3,159,293 Q97L unknown Het
Sdr9c7 G A 10: 127,898,882 V80I probably benign Het
Slc18a1 A G 8: 69,075,147 V4A probably benign Het
Slirp T C 12: 87,447,600 V45A probably damaging Het
Spata31 A T 13: 64,922,804 Q922L probably benign Het
Spg11 A G 2: 122,097,321 S661P possibly damaging Het
Stab2 G T 10: 86,846,052 T2495K probably benign Het
Supt16 A G 14: 52,170,875 I871T probably damaging Het
Sval2 A G 6: 41,860,364 Q9R probably damaging Het
Tfpi A T 2: 84,453,922 M62K possibly damaging Het
Tm4sf1 A T 3: 57,287,765 Y200* probably null Het
Tmc1 A T 19: 20,900,817 W105R probably damaging Het
Tmtc2 T C 10: 105,190,126 E827G probably benign Het
Tollip T C 7: 141,892,826 I33V probably benign Het
Unc80 T A 1: 66,606,644 V1493D possibly damaging Het
Vmn2r6 G A 3: 64,559,824 R85W probably benign Het
Vwa5a C A 9: 38,736,020 S565* probably null Het
Xbp1 T A 11: 5,521,910 V12D probably benign Het
Other mutations in Syngap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0732:Syngap1 UTSW 17 26954988 missense possibly damaging 0.94
R1178:Syngap1 UTSW 17 26957805 missense probably damaging 0.99
R1680:Syngap1 UTSW 17 26952579 missense possibly damaging 0.60
R1953:Syngap1 UTSW 17 26944687 missense possibly damaging 0.94
R2213:Syngap1 UTSW 17 26953069 missense probably damaging 1.00
R2696:Syngap1 UTSW 17 26957411 nonsense probably null
R2899:Syngap1 UTSW 17 26959985 missense probably damaging 1.00
R3237:Syngap1 UTSW 17 26957093 nonsense probably null
R3705:Syngap1 UTSW 17 26960020 missense probably damaging 1.00
R3880:Syngap1 UTSW 17 26953064 missense probably damaging 1.00
R4019:Syngap1 UTSW 17 26952341 unclassified probably benign
R4661:Syngap1 UTSW 17 26966906 missense probably damaging 1.00
R4798:Syngap1 UTSW 17 26961449 missense probably benign 0.00
R5524:Syngap1 UTSW 17 26957152 missense probably damaging 1.00
R5580:Syngap1 UTSW 17 26962331 missense probably damaging 0.97
R5610:Syngap1 UTSW 17 26959780 missense possibly damaging 0.68
R5835:Syngap1 UTSW 17 26958218 missense probably benign 0.09
R5974:Syngap1 UTSW 17 26963038 missense probably damaging 0.98
R6235:Syngap1 UTSW 17 26958130 missense probably benign 0.00
R6247:Syngap1 UTSW 17 26962957 nonsense probably null
R6461:Syngap1 UTSW 17 26964848 missense probably damaging 1.00
R6503:Syngap1 UTSW 17 26944684 missense probably benign 0.40
R7134:Syngap1 UTSW 17 26960011 missense probably damaging 1.00
R7248:Syngap1 UTSW 17 26957767 missense probably damaging 1.00
R7298:Syngap1 UTSW 17 26962987 missense possibly damaging 0.85
R7749:Syngap1 UTSW 17 26959964 missense probably damaging 0.99
R7812:Syngap1 UTSW 17 26941504 missense probably benign
R7864:Syngap1 UTSW 17 26970528 missense
R8132:Syngap1 UTSW 17 26958180 missense probably damaging 0.98
X0017:Syngap1 UTSW 17 26944651 missense probably benign 0.11
Z1088:Syngap1 UTSW 17 26961576 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTATGAGTCAGGGGTCCCTC -3'
(R):5'- CTTGAAAAGGCCCGTGTCCC -3'

Sequencing Primer
(F):5'- AGTCAGGGGTCCCTCGTTCTC -3'
(R):5'- GTGTCCCAGCCCCTCTATC -3'
Posted On2020-01-23