Incidental Mutation 'R8024:Ints5'
ID617617
Institutional Source Beutler Lab
Gene Symbol Ints5
Ensembl Gene ENSMUSG00000116347
Gene Name
Synonyms1110055N21Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.352) question?
Stock #R8024 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location8888926-8895227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8896140 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 488 (L488I)
Ref Sequence ENSEMBL: ENSMUSP00000093968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096246] [ENSMUST00000096249] [ENSMUST00000187504] [ENSMUST00000191089]
Predicted Effect probably benign
Transcript: ENSMUST00000096246
SMART Domains Protein: ENSMUSP00000093965
Gene: ENSMUSG00000071650

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 157 169 N/A INTRINSIC
Pfam:Gal_mutarotas_2 275 346 3.9e-24 PFAM
Pfam:Glyco_hydro_31 387 832 8.7e-136 PFAM
low complexity region 888 898 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000096249
AA Change: L488I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093968
Gene: ENSMUSG00000071652
AA Change: L488I

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:INTS5_N 29 252 1e-82 PFAM
low complexity region 254 267 N/A INTRINSIC
Pfam:INTS5_C 289 998 2.2e-249 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187504
SMART Domains Protein: ENSMUSP00000139692
Gene: ENSMUSG00000096740

DomainStartEndE-ValueType
Pfam:Lbh 1 101 2.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191089
SMART Domains Protein: ENSMUSP00000140564
Gene: ENSMUSG00000116347

DomainStartEndE-ValueType
low complexity region 15 37 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Integrator complex is a complex that associates with the C-terminal domain of RNA polymerase II large subunit. This complex is brought to U1 and U2 small nuclear RNA genes, where it is involved in the transcription and processing of their transcripts. The protein encoded by this gene represents a subunit of the Integrator complex. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,612,594 N1257Y probably benign Het
2310057J18Rik A T 10: 28,982,595 Y133* probably null Het
2310057J18Rik A C 10: 28,986,217 S26A possibly damaging Het
4931409K22Rik A G 5: 24,550,636 M296T possibly damaging Het
9930012K11Rik G T 14: 70,156,667 P220T probably damaging Het
A430105I19Rik A G 2: 118,760,524 probably null Het
Adam1b A C 5: 121,500,923 S686R probably benign Het
Adam8 T C 7: 139,987,576 D418G probably damaging Het
Adcy8 A G 15: 64,920,246 L287P probably damaging Het
Adhfe1 T A 1: 9,563,855 M373K probably benign Het
Alpk2 T C 18: 65,305,035 S1096G probably benign Het
Ankmy1 A G 1: 92,884,994 V531A probably benign Het
Ano3 C T 2: 110,667,783 E738K probably damaging Het
Ano4 T A 10: 88,971,332 I796F probably damaging Het
Apeh T C 9: 108,092,591 E190G probably benign Het
Cadm3 A G 1: 173,338,055 L346P probably damaging Het
Clec2e G A 6: 129,094,425 H150Y possibly damaging Het
Cnga4 A T 7: 105,406,835 N318Y probably damaging Het
Cnr2 T A 4: 135,916,885 F91L probably damaging Het
Diaph3 T A 14: 86,656,399 E1147V probably damaging Het
Elmo2 T C 2: 165,291,855 T738A unknown Het
Exoc4 T A 6: 33,347,931 W387R probably damaging Het
Fam173b T C 15: 31,608,171 Y123H probably damaging Het
Focad T C 4: 88,397,000 V1379A unknown Het
Frmd4a T C 2: 4,603,702 S794P probably damaging Het
Ftl1-ps1 A G 13: 74,407,051 T150A probably benign Het
Gm5773 C T 3: 93,773,168 A49V probably benign Het
Helz T A 11: 107,686,421 L1867Q unknown Het
Il22ra1 A G 4: 135,734,278 H118R probably benign Het
Inf2 C T 12: 112,608,902 P856S unknown Het
Kifc1 G A 17: 33,883,203 R479C probably damaging Het
Lrba T A 3: 86,295,401 C289* probably null Het
Mael A G 1: 166,226,627 L196S probably damaging Het
Med23 T A 10: 24,879,683 S229R possibly damaging Het
Mroh9 T C 1: 163,039,233 N645D probably benign Het
Myom3 G A 4: 135,801,748 V1132I probably benign Het
Ndufa13 A T 8: 69,894,537 L71H probably damaging Het
Nepro A T 16: 44,731,415 H212L probably benign Het
Nox4 T A 7: 87,304,910 L141Q probably damaging Het
Olfr1254 T C 2: 89,789,046 E102G probably benign Het
Olfr283 T A 15: 98,378,997 M38L probably benign Het
Olfr473 T C 7: 107,934,438 V306A probably benign Het
Olfr482 T A 7: 108,095,289 T94S probably benign Het
Olfr811 T G 10: 129,801,943 E194A probably damaging Het
Pfpl A G 19: 12,430,206 D607G possibly damaging Het
Pkd1l2 A T 8: 117,076,182 F233L possibly damaging Het
Ptprz1 A T 6: 23,042,751 E2058V probably damaging Het
Rag1 A T 2: 101,642,507 N763K probably damaging Het
Rhbg A C 3: 88,248,453 D63E probably damaging Het
Rrm1 T A 7: 102,457,265 F330L probably benign Het
Scaf8 A T 17: 3,159,293 Q97L unknown Het
Sdr9c7 G A 10: 127,898,882 V80I probably benign Het
Slc18a1 A G 8: 69,075,147 V4A probably benign Het
Slirp T C 12: 87,447,600 V45A probably damaging Het
Spata31 A T 13: 64,922,804 Q922L probably benign Het
Spg11 A G 2: 122,097,321 S661P possibly damaging Het
Stab2 G T 10: 86,846,052 T2495K probably benign Het
Supt16 A G 14: 52,170,875 I871T probably damaging Het
Sval2 A G 6: 41,860,364 Q9R probably damaging Het
Syngap1 A T 17: 26,941,452 M1L probably benign Het
Tfpi A T 2: 84,453,922 M62K possibly damaging Het
Tm4sf1 A T 3: 57,287,765 Y200* probably null Het
Tmc1 A T 19: 20,900,817 W105R probably damaging Het
Tmtc2 T C 10: 105,190,126 E827G probably benign Het
Tollip T C 7: 141,892,826 I33V probably benign Het
Unc80 T A 1: 66,606,644 V1493D possibly damaging Het
Vmn2r6 G A 3: 64,559,824 R85W probably benign Het
Vwa5a C A 9: 38,736,020 S565* probably null Het
Xbp1 T A 11: 5,521,910 V12D probably benign Het
Other mutations in Ints5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Ints5 APN 19 8895487 missense possibly damaging 0.93
IGL01915:Ints5 APN 19 8896993 missense probably benign
IGL01993:Ints5 APN 19 8895465 missense probably benign
IGL02264:Ints5 APN 19 8895712 missense probably benign 0.02
IGL02367:Ints5 APN 19 8895595 missense probably benign 0.06
IGL02955:Ints5 APN 19 8897650 missense probably damaging 1.00
FR4449:Ints5 UTSW 19 8897230 missense probably benign 0.10
R0348:Ints5 UTSW 19 8895750 missense probably damaging 0.97
R0379:Ints5 UTSW 19 8897133 missense possibly damaging 0.90
R0617:Ints5 UTSW 19 8896019 missense probably damaging 1.00
R1954:Ints5 UTSW 19 8894896 missense probably damaging 1.00
R2172:Ints5 UTSW 19 8896282 missense possibly damaging 0.73
R2370:Ints5 UTSW 19 8896779 missense probably benign
R3116:Ints5 UTSW 19 8894772 missense possibly damaging 0.84
R4395:Ints5 UTSW 19 8896444 missense probably damaging 0.96
R5390:Ints5 UTSW 19 8896567 missense possibly damaging 0.73
R6868:Ints5 UTSW 19 8897386 missense probably damaging 1.00
R7133:Ints5 UTSW 19 8895559 missense probably damaging 1.00
R7685:Ints5 UTSW 19 8896804 missense probably benign 0.10
R7999:Ints5 UTSW 19 8897043 missense probably benign
X0066:Ints5 UTSW 19 8896231 missense probably damaging 1.00
Z1177:Ints5 UTSW 19 8894935 missense probably benign 0.31
Z1177:Ints5 UTSW 19 8894973 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGACACAGCTATGCCTGCTTC -3'
(R):5'- GACCACTAGCCCTGCATATAG -3'

Sequencing Primer
(F):5'- AGTTATTACTACCCAGGGCCTGG -3'
(R):5'- ATAGCTGGGTTGCCAAACTC -3'
Posted On2020-01-23