Incidental Mutation 'R8025:Dennd1b'
ID617621
Institutional Source Beutler Lab
Gene Symbol Dennd1b
Ensembl Gene ENSMUSG00000056268
Gene NameDENN/MADD domain containing 1B
Synonyms4632404N19Rik, 6820401H01Rik, 4930467M19Rik, F730008N07Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8025 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location138963435-139178960 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139110420 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 267 (K267E)
Ref Sequence ENSEMBL: ENSMUSP00000092082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094505] [ENSMUST00000168527] [ENSMUST00000200429]
Predicted Effect
SMART Domains Protein: ENSMUSP00000092082
Gene: ENSMUSG00000056268
AA Change: K267E

DomainStartEndE-ValueType
DENN 15 196 1.14e-74 SMART
dDENN 227 293 1.07e-20 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000127580
Gene: ENSMUSG00000056268
AA Change: K342E

DomainStartEndE-ValueType
uDENN 9 89 7.86e-28 SMART
DENN 90 271 1.14e-74 SMART
dDENN 302 368 1.07e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200429
SMART Domains Protein: ENSMUSP00000143783
Gene: ENSMUSG00000056268

DomainStartEndE-ValueType
uDENN 9 89 3.2e-31 SMART
DENN 90 271 4.8e-78 SMART
low complexity region 307 318 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Clathrin (see MIM 118955)-mediated endocytosis is a major mechanism for internalization of proteins and lipids. Members of the connecdenn family, such as DENND1B, function as guanine nucleotide exchange factors (GEFs) for the early endosomal small GTPase RAB35 (MIM 604199) and bind to clathrin and clathrin adaptor protein-2 (AP2; see MIM 601024). Thus, connecdenns link RAB35 activation with the clathrin machinery (Marat and McPherson, 2010 [PubMed 20154091]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous KO results in enhanced allergic responses to aerosolized antigen challenges caused by delayed TCR down-modulation following receptor activation in T helper 2 cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579G24Rik T G 3: 79,629,328 L51R probably damaging Het
Actl7b T C 4: 56,741,137 T74A probably damaging Het
Aip C A 19: 4,115,346 A207S probably benign Het
AL732309.1 A G 2: 25,246,319 probably benign Het
Apcdd1 G T 18: 62,936,908 C82F probably damaging Het
Arhgap42 T G 9: 9,005,822 I736L probably benign Het
Armc4 A T 18: 7,127,224 N996K probably benign Het
Baz1a A T 12: 54,909,136 I1056N probably benign Het
Bzw2 T C 12: 36,107,518 E316G probably damaging Het
Carns1 A T 19: 4,166,506 I559N probably damaging Het
Ccdc144b C A 3: 36,018,987 R382L probably damaging Het
Chrnb2 A T 3: 89,761,342 V222E probably damaging Het
Cngb3 A T 4: 19,280,960 N10Y possibly damaging Het
Dhx32 A G 7: 133,721,371 Y705H probably damaging Het
Dnah7c G A 1: 46,457,296 V114I probably benign Het
Dnah8 T A 17: 30,741,337 C2229* probably null Het
Gm14401 T C 2: 177,086,456 F112L probably damaging Het
Gm9573 GTGCTGGATTCAGTGGTGGGCAGGGTGGGGGTAGAGCCTGAGCCACTGCTGGATGCAGTGGTGGTCAGGGTGGGTGTAGAGCCTGAGCCA GTGCTGGATGCAGTGGTGGTCAGGGTGGGTGTAGAGCCTGAGCCA 17: 35,620,987 probably benign Het
Habp4 G A 13: 64,174,831 R238H probably benign Het
Herpud1 A G 8: 94,392,521 Y301C probably damaging Het
Itih5 G A 2: 10,241,022 A641T probably benign Het
Kcns3 A T 12: 11,091,845 N284K probably damaging Het
Mcrs1 G A 15: 99,246,933 Q267* probably null Het
Midn G A 10: 80,155,292 A379T probably benign Het
Olfr1028 A T 2: 85,951,512 I150F probably benign Het
Olfr462 A T 11: 87,888,951 probably null Het
Olfr561 T C 7: 102,775,256 V244A probably benign Het
Olfr716 A G 7: 107,147,723 M136V possibly damaging Het
Olfr869 T C 9: 20,137,632 V172A probably benign Het
Parpbp T C 10: 88,093,108 D490G probably benign Het
Pcbp2 T A 15: 102,488,276 S262R probably benign Het
Pcdhgc5 T C 18: 37,820,939 I422T possibly damaging Het
Plxna1 G A 6: 89,331,272 R1278W probably damaging Het
Polr1c A G 17: 46,245,048 L162P probably damaging Het
Rasl2-9 A G 7: 5,125,482 S150P probably damaging Het
Raver2 C A 4: 101,102,965 S214* probably null Het
Rec114 T G 9: 58,660,322 E127A possibly damaging Het
Recql5 C A 11: 115,928,112 L209F probably damaging Het
Rgs11 T C 17: 26,204,385 probably null Het
Rgs3 C A 4: 62,690,594 H366N probably damaging Het
Rnf148 C T 6: 23,654,197 D267N possibly damaging Het
Scn1a T C 2: 66,318,213 N1007S probably benign Het
Sdcbp A G 4: 6,393,022 T220A probably benign Het
Sema5a A G 15: 32,548,782 N134S probably benign Het
Smg1 G A 7: 118,206,989 Q210* probably null Het
Snx7 A G 3: 117,832,877 V328A probably benign Het
Sult1c2 A T 17: 53,831,809 S247T probably benign Het
Tceanc2 C T 4: 107,139,800 probably null Het
Tead3 T C 17: 28,335,035 D141G probably benign Het
Tmem136 T A 9: 43,111,553 T169S probably benign Het
Ube3b T C 5: 114,408,209 M692T probably damaging Het
Vmn1r188 T C 13: 22,087,914 F13L probably benign Het
Vmn2r3 A G 3: 64,275,450 V276A possibly damaging Het
Vmn2r57 A G 7: 41,426,759 I443T probably benign Het
Vps33a T C 5: 123,558,675 N305S possibly damaging Het
Wdr34 T C 2: 30,048,718 Q51R probably benign Het
Wdr72 T A 9: 74,143,499 M91K probably benign Het
Xylb T C 9: 119,381,503 F351L probably damaging Het
Zan C T 5: 137,406,352 D3883N unknown Het
Zfp82 T A 7: 30,056,853 H268L probably damaging Het
Other mutations in Dennd1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Dennd1b APN 1 139062940 missense probably damaging 1.00
IGL00510:Dennd1b APN 1 139102071 missense probably damaging 1.00
IGL00671:Dennd1b APN 1 139133737 missense possibly damaging 0.94
IGL00937:Dennd1b APN 1 139170239 missense probably benign 0.01
IGL00959:Dennd1b APN 1 139143888 splice site probably benign
IGL01446:Dennd1b APN 1 139023110 missense possibly damaging 0.61
IGL01610:Dennd1b APN 1 139169766 utr 3 prime probably benign
IGL02275:Dennd1b APN 1 139081254 missense probably damaging 1.00
IGL02851:Dennd1b APN 1 139168967 utr 3 prime probably benign
IGL02995:Dennd1b APN 1 139081242 missense probably damaging 1.00
IGL03089:Dennd1b APN 1 139102029 missense possibly damaging 0.94
IGL03240:Dennd1b APN 1 139139392 missense possibly damaging 0.63
IGL03267:Dennd1b APN 1 139062861 nonsense probably null
Dendrite UTSW 1 139053417 critical splice donor site probably null
LCD18:Dennd1b UTSW 1 139114764 intron probably benign
PIT4418001:Dennd1b UTSW 1 139081261 missense
PIT4504001:Dennd1b UTSW 1 139040004 missense probably benign 0.28
R0426:Dennd1b UTSW 1 139170196 missense probably benign
R0445:Dennd1b UTSW 1 139167765 splice site probably benign
R0497:Dennd1b UTSW 1 139039986 splice site probably benign
R0627:Dennd1b UTSW 1 139081219 missense probably damaging 1.00
R1027:Dennd1b UTSW 1 139041962 missense probably damaging 1.00
R1599:Dennd1b UTSW 1 139167730 missense probably benign 0.01
R1703:Dennd1b UTSW 1 139169754 critical splice acceptor site probably null
R1844:Dennd1b UTSW 1 139090405 intron probably null
R1943:Dennd1b UTSW 1 139168952 utr 3 prime probably benign
R2504:Dennd1b UTSW 1 139170170 utr 3 prime probably benign
R2866:Dennd1b UTSW 1 139170281 missense possibly damaging 0.58
R3109:Dennd1b UTSW 1 139041916 splice site probably benign
R3843:Dennd1b UTSW 1 139053354 missense probably damaging 1.00
R3926:Dennd1b UTSW 1 139143959 missense probably benign 0.00
R4258:Dennd1b UTSW 1 139062940 missense probably damaging 1.00
R4504:Dennd1b UTSW 1 139085927 missense possibly damaging 0.82
R4805:Dennd1b UTSW 1 139053384 missense probably damaging 1.00
R4922:Dennd1b UTSW 1 139085914 missense probably damaging 0.99
R4954:Dennd1b UTSW 1 139053386 missense probably damaging 1.00
R5098:Dennd1b UTSW 1 139133721 missense probably damaging 0.97
R5205:Dennd1b UTSW 1 139054568 missense probably benign 0.00
R5240:Dennd1b UTSW 1 139062877 missense probably damaging 1.00
R5383:Dennd1b UTSW 1 139167671 missense probably benign
R5504:Dennd1b UTSW 1 139090508 missense probably benign 0.07
R5702:Dennd1b UTSW 1 139133675 missense probably damaging 1.00
R5801:Dennd1b UTSW 1 139039989 splice site probably null
R6144:Dennd1b UTSW 1 139081255 missense probably damaging 1.00
R6190:Dennd1b UTSW 1 139133675 missense probably damaging 1.00
R6192:Dennd1b UTSW 1 139167718 missense probably benign 0.00
R6289:Dennd1b UTSW 1 139168945 utr 3 prime probably benign
R6453:Dennd1b UTSW 1 139143948 missense probably benign 0.07
R6479:Dennd1b UTSW 1 139041960 intron probably benign
R6940:Dennd1b UTSW 1 139053417 critical splice donor site probably null
R6954:Dennd1b UTSW 1 139168945 utr 3 prime probably benign
R7183:Dennd1b UTSW 1 139170252 missense unknown
R7710:Dennd1b UTSW 1 139062932 missense probably damaging 1.00
R7742:Dennd1b UTSW 1 139062873 missense probably damaging 1.00
R7796:Dennd1b UTSW 1 139062873 missense probably damaging 1.00
R7871:Dennd1b UTSW 1 139062873 missense probably damaging 1.00
R7954:Dennd1b UTSW 1 139062873 missense probably damaging 1.00
RF008:Dennd1b UTSW 1 139053397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAAGTATGCCAAGTGGG -3'
(R):5'- CCTCCTGATTCAGAGAAGACATC -3'

Sequencing Primer
(F):5'- ACAGGACCTATTTGTGATTCCCAG -3'
(R):5'- GAAGACATCTCTCAGGACATGATTG -3'
Posted On2020-01-23