Incidental Mutation 'R8025:Actl7b'
ID617635
Institutional Source Beutler Lab
Gene Symbol Actl7b
Ensembl Gene ENSMUSG00000070980
Gene Nameactin-like 7b
SynonymsENSMUSG00000070980, Tact1, t-actin 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8025 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location56740005-56741443 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56741137 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 74 (T74A)
Ref Sequence ENSEMBL: ENSMUSP00000092693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095079] [ENSMUST00000095080] [ENSMUST00000181745]
Predicted Effect probably benign
Transcript: ENSMUST00000095079
SMART Domains Protein: ENSMUSP00000092692
Gene: ENSMUSG00000070979

DomainStartEndE-ValueType
Pfam:ACTL7A_N 6 70 1.3e-39 PFAM
ACTIN 74 440 4.63e-123 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095080
AA Change: T74A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092693
Gene: ENSMUSG00000070980
AA Change: T74A

DomainStartEndE-ValueType
ACTIN 51 418 1.6e-117 SMART
Predicted Effect silent
Transcript: ENSMUST00000181745
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of actin-related proteins (ARPs) which share significant amino acid sequence identity to conventional actins. Both actins and ARPs have an actin fold, which is an ATP-binding cleft, as a common feature. The ARPs are involved in diverse cellular processes, including vesicular transport, spindle orientation, nuclear migration and chromatin remodeling. This gene (ACTL7B), and related gene, ACTL7A, are intronless, and are located approximately 4 kb apart in a head-to-head orientation within the familial dysautonomia candidate region on 9q31. Based on mutational analysis of the ACTL7B gene in patients with this disorder, it was concluded that it is unlikely to be involved in the pathogenesis of dysautonomia. Unlike ACTL7A, the ACTL7B gene is expressed predominantly in the testis, however, its exact function is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579G24Rik T G 3: 79,629,328 L51R probably damaging Het
Aip C A 19: 4,115,346 A207S probably benign Het
AL732309.1 A G 2: 25,246,319 probably benign Het
Apcdd1 G T 18: 62,936,908 C82F probably damaging Het
Arhgap42 T G 9: 9,005,822 I736L probably benign Het
Armc4 A T 18: 7,127,224 N996K probably benign Het
Baz1a A T 12: 54,909,136 I1056N probably benign Het
Bzw2 T C 12: 36,107,518 E316G probably damaging Het
Carns1 A T 19: 4,166,506 I559N probably damaging Het
Ccdc144b C A 3: 36,018,987 R382L probably damaging Het
Chrnb2 A T 3: 89,761,342 V222E probably damaging Het
Cngb3 A T 4: 19,280,960 N10Y possibly damaging Het
Dennd1b A G 1: 139,110,420 K267E Het
Dhx32 A G 7: 133,721,371 Y705H probably damaging Het
Dnah7c G A 1: 46,457,296 V114I probably benign Het
Dnah8 T A 17: 30,741,337 C2229* probably null Het
Gm14401 T C 2: 177,086,456 F112L probably damaging Het
Gm9573 GTGCTGGATTCAGTGGTGGGCAGGGTGGGGGTAGAGCCTGAGCCACTGCTGGATGCAGTGGTGGTCAGGGTGGGTGTAGAGCCTGAGCCA GTGCTGGATGCAGTGGTGGTCAGGGTGGGTGTAGAGCCTGAGCCA 17: 35,620,987 probably benign Het
Habp4 G A 13: 64,174,831 R238H probably benign Het
Herpud1 A G 8: 94,392,521 Y301C probably damaging Het
Itih5 G A 2: 10,241,022 A641T probably benign Het
Kcns3 A T 12: 11,091,845 N284K probably damaging Het
Mcrs1 G A 15: 99,246,933 Q267* probably null Het
Midn G A 10: 80,155,292 A379T probably benign Het
Olfr1028 A T 2: 85,951,512 I150F probably benign Het
Olfr462 A T 11: 87,888,951 probably null Het
Olfr561 T C 7: 102,775,256 V244A probably benign Het
Olfr716 A G 7: 107,147,723 M136V possibly damaging Het
Olfr869 T C 9: 20,137,632 V172A probably benign Het
Parpbp T C 10: 88,093,108 D490G probably benign Het
Pcbp2 T A 15: 102,488,276 S262R probably benign Het
Pcdhgc5 T C 18: 37,820,939 I422T possibly damaging Het
Pcsk5 T A 19: 17,561,051 probably benign Het
Plxna1 G A 6: 89,331,272 R1278W probably damaging Het
Polr1c A G 17: 46,245,048 L162P probably damaging Het
Rasl2-9 A G 7: 5,125,482 S150P probably damaging Het
Raver2 C A 4: 101,102,965 S214* probably null Het
Rbpjl C A 2: 164,410,246 probably benign Het
Rec114 T G 9: 58,660,322 E127A possibly damaging Het
Recql5 C A 11: 115,928,112 L209F probably damaging Het
Rgs11 T C 17: 26,204,385 probably null Het
Rgs3 C A 4: 62,690,594 H366N probably damaging Het
Rnf148 C T 6: 23,654,197 D267N possibly damaging Het
Scn1a T C 2: 66,318,213 N1007S probably benign Het
Sdcbp A G 4: 6,393,022 T220A probably benign Het
Sema5a A G 15: 32,548,782 N134S probably benign Het
Smg1 G A 7: 118,206,989 Q210* probably null Het
Snx7 A G 3: 117,832,877 V328A probably benign Het
Sult1c2 A T 17: 53,831,809 S247T probably benign Het
Tceanc2 C T 4: 107,139,800 probably null Het
Tead3 T C 17: 28,335,035 D141G probably benign Het
Tmem136 T A 9: 43,111,553 T169S probably benign Het
Ube3b T C 5: 114,408,209 M692T probably damaging Het
Vmn1r188 T C 13: 22,087,914 F13L probably benign Het
Vmn2r3 A G 3: 64,275,450 V276A possibly damaging Het
Vmn2r57 A G 7: 41,426,759 I443T probably benign Het
Vps33a T C 5: 123,558,675 N305S possibly damaging Het
Vps33b A T 7: 80,290,346 probably benign Het
Wdr34 T C 2: 30,048,718 Q51R probably benign Het
Wdr72 T A 9: 74,143,499 M91K probably benign Het
Xylb T C 9: 119,381,503 F351L probably damaging Het
Zan C T 5: 137,406,352 D3883N unknown Het
Zfp82 T A 7: 30,056,853 H268L probably damaging Het
Other mutations in Actl7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01514:Actl7b APN 4 56740677 missense probably damaging 1.00
IGL02252:Actl7b APN 4 56741205 missense probably damaging 0.97
IGL02927:Actl7b APN 4 56740609 missense probably damaging 1.00
IGL03370:Actl7b APN 4 56741173 missense probably damaging 1.00
R0294:Actl7b UTSW 4 56740848 missense possibly damaging 0.83
R1711:Actl7b UTSW 4 56740165 nonsense probably null
R4773:Actl7b UTSW 4 56740972 missense probably benign
R6110:Actl7b UTSW 4 56740224 missense probably damaging 1.00
R6423:Actl7b UTSW 4 56741213 missense probably benign 0.03
R7039:Actl7b UTSW 4 56741022 missense probably damaging 0.98
R7250:Actl7b UTSW 4 56741035 missense probably benign 0.00
R7604:Actl7b UTSW 4 56740693 missense probably benign
R8352:Actl7b UTSW 4 56740251 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCGGTGTGGAAGATGTACTC -3'
(R):5'- TTCTTCCCAGGAGCTCTAGG -3'

Sequencing Primer
(F):5'- GGAAGATGTACTCCCAGATGTTC -3'
(R):5'- CTTCCCAGGAGCTCTAGGGTATG -3'
Posted On2020-01-23