Incidental Mutation 'R8025:Olfr716'
ID 617648
Institutional Source Beutler Lab
Gene Symbol Olfr716
Ensembl Gene ENSMUSG00000073896
Gene Name olfactory receptor 716
Synonyms GA_x6K02T2PBJ9-9497411-9498355, MOR260-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock # R8025 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 107138327-107150581 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 107147723 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 136 (M136V)
Ref Sequence ENSEMBL: ENSMUSP00000147429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098137] [ENSMUST00000209942] [ENSMUST00000210474] [ENSMUST00000213367] [ENSMUST00000214819] [ENSMUST00000215284] [ENSMUST00000216871]
AlphaFold Q9EPG6
Predicted Effect possibly damaging
Transcript: ENSMUST00000098137
AA Change: M136V

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095740
Gene: ENSMUSG00000073896
AA Change: M136V

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.4e-57 PFAM
Pfam:7tm_1 41 290 3.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209942
Predicted Effect possibly damaging
Transcript: ENSMUST00000210474
AA Change: M136V

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213367
AA Change: M136V

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214819
AA Change: M136V

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215284
AA Change: M136V

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216871
AA Change: M136V

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.2563 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579G24Rik T G 3: 79,629,328 L51R probably damaging Het
Actl7b T C 4: 56,741,137 T74A probably damaging Het
Aip C A 19: 4,115,346 A207S probably benign Het
AL732309.1 A G 2: 25,246,319 probably benign Het
Apcdd1 G T 18: 62,936,908 C82F probably damaging Het
Arhgap42 T G 9: 9,005,822 I736L probably benign Het
Armc4 A T 18: 7,127,224 N996K probably benign Het
Baz1a A T 12: 54,909,136 I1056N probably benign Het
Bzw2 T C 12: 36,107,518 E316G probably damaging Het
Carns1 A T 19: 4,166,506 I559N probably damaging Het
Ccdc144b C A 3: 36,018,987 R382L probably damaging Het
Chrnb2 A T 3: 89,761,342 V222E probably damaging Het
Cngb3 A T 4: 19,280,960 N10Y possibly damaging Het
Dennd1b A G 1: 139,110,420 K267E Het
Dhx32 A G 7: 133,721,371 Y705H probably damaging Het
Dnah7c G A 1: 46,457,296 V114I probably benign Het
Dnah8 T A 17: 30,741,337 C2229* probably null Het
Gm14401 T C 2: 177,086,456 F112L probably damaging Het
Gm9573 GTGCTGGATTCAGTGGTGGGCAGGGTGGGGGTAGAGCCTGAGCCACTGCTGGATGCAGTGGTGGTCAGGGTGGGTGTAGAGCCTGAGCCA GTGCTGGATGCAGTGGTGGTCAGGGTGGGTGTAGAGCCTGAGCCA 17: 35,620,987 probably benign Het
Habp4 G A 13: 64,174,831 R238H probably benign Het
Herpud1 A G 8: 94,392,521 Y301C probably damaging Het
Itih5 G A 2: 10,241,022 A641T probably benign Het
Kcns3 A T 12: 11,091,845 N284K probably damaging Het
Mcrs1 G A 15: 99,246,933 Q267* probably null Het
Midn G A 10: 80,155,292 A379T probably benign Het
Olfr1028 A T 2: 85,951,512 I150F probably benign Het
Olfr462 A T 11: 87,888,951 probably null Het
Olfr561 T C 7: 102,775,256 V244A probably benign Het
Olfr869 T C 9: 20,137,632 V172A probably benign Het
Parpbp T C 10: 88,093,108 D490G probably benign Het
Pcbp2 T A 15: 102,488,276 S262R probably benign Het
Pcdhgc5 T C 18: 37,820,939 I422T possibly damaging Het
Pcsk5 T A 19: 17,561,051 probably benign Het
Plxna1 G A 6: 89,331,272 R1278W probably damaging Het
Polr1c A G 17: 46,245,048 L162P probably damaging Het
Rasl2-9 A G 7: 5,125,482 S150P probably damaging Het
Raver2 C A 4: 101,102,965 S214* probably null Het
Rbpjl C A 2: 164,410,246 probably benign Het
Rec114 T G 9: 58,660,322 E127A possibly damaging Het
Recql5 C A 11: 115,928,112 L209F probably damaging Het
Rgs11 T C 17: 26,204,385 probably null Het
Rgs3 C A 4: 62,690,594 H366N probably damaging Het
Rnf148 C T 6: 23,654,197 D267N possibly damaging Het
Scn1a T C 2: 66,318,213 N1007S probably benign Het
Sdcbp A G 4: 6,393,022 T220A probably benign Het
Sema5a A G 15: 32,548,782 N134S probably benign Het
Smg1 G A 7: 118,206,989 Q210* probably null Het
Snx7 A G 3: 117,832,877 V328A probably benign Het
Sult1c2 A T 17: 53,831,809 S247T probably benign Het
Tceanc2 C T 4: 107,139,800 probably null Het
Tead3 T C 17: 28,335,035 D141G probably benign Het
Tmem136 T A 9: 43,111,553 T169S probably benign Het
Ube3b T C 5: 114,408,209 M692T probably damaging Het
Vmn1r188 T C 13: 22,087,914 F13L probably benign Het
Vmn2r3 A G 3: 64,275,450 V276A possibly damaging Het
Vmn2r57 A G 7: 41,426,759 I443T probably benign Het
Vps33a T C 5: 123,558,675 N305S possibly damaging Het
Vps33b A T 7: 80,290,346 probably benign Het
Wdr34 T C 2: 30,048,718 Q51R probably benign Het
Wdr72 T A 9: 74,143,499 M91K probably benign Het
Xylb T C 9: 119,381,503 F351L probably damaging Het
Zan C T 5: 137,406,352 D3883N unknown Het
Zfp82 T A 7: 30,056,853 H268L probably damaging Het
Other mutations in Olfr716
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01781:Olfr716 APN 7 107147696 missense probably damaging 1.00
IGL02792:Olfr716 APN 7 107148218 missense probably benign 0.00
IGL03300:Olfr716 APN 7 107147409 missense probably damaging 1.00
R0071:Olfr716 UTSW 7 107147712 missense probably damaging 1.00
R0071:Olfr716 UTSW 7 107147712 missense probably damaging 1.00
R0391:Olfr716 UTSW 7 107148187 nonsense probably null
R0962:Olfr716 UTSW 7 107148087 missense possibly damaging 0.94
R1440:Olfr716 UTSW 7 107148198 missense probably damaging 1.00
R5561:Olfr716 UTSW 7 107148090 missense probably benign 0.05
R5700:Olfr716 UTSW 7 107147541 missense probably benign
R5997:Olfr716 UTSW 7 107147328 missense possibly damaging 0.79
R6262:Olfr716 UTSW 7 107147711 missense probably damaging 1.00
R6922:Olfr716 UTSW 7 107148083 missense probably damaging 0.98
R7076:Olfr716 UTSW 7 107148029 missense probably damaging 1.00
R9256:Olfr716 UTSW 7 107148180 missense probably damaging 0.99
R9746:Olfr716 UTSW 7 107147453 missense probably benign 0.14
Z1088:Olfr716 UTSW 7 107148212 missense probably benign
Z1176:Olfr716 UTSW 7 107148155 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GCATTGTTCCTCAAGTGCTG -3'
(R):5'- GTGCTAGGAGGATTACCACACC -3'

Sequencing Primer
(F):5'- TGTCCCACTTCCTGGTAAAAAGG -3'
(R):5'- CAAAGATGGCCATTTCTGTGC -3'
Posted On 2020-01-23