Incidental Mutation 'R8025:Olfr869'
ID617653
Institutional Source Beutler Lab
Gene Symbol Olfr869
Ensembl Gene ENSMUSG00000058491
Gene Nameolfactory receptor 869
SynonymsMOR145-6, GA_x6K02T2PVTD-13878275-13879204
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R8025 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location20129009-20138763 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20137632 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 172 (V172A)
Ref Sequence ENSEMBL: ENSMUSP00000154723 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000213024
AA Change: V172A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579G24Rik T G 3: 79,629,328 L51R probably damaging Het
Actl7b T C 4: 56,741,137 T74A probably damaging Het
Aip C A 19: 4,115,346 A207S probably benign Het
AL732309.1 A G 2: 25,246,319 probably benign Het
Apcdd1 G T 18: 62,936,908 C82F probably damaging Het
Arhgap42 T G 9: 9,005,822 I736L probably benign Het
Armc4 A T 18: 7,127,224 N996K probably benign Het
Baz1a A T 12: 54,909,136 I1056N probably benign Het
Bzw2 T C 12: 36,107,518 E316G probably damaging Het
Carns1 A T 19: 4,166,506 I559N probably damaging Het
Ccdc144b C A 3: 36,018,987 R382L probably damaging Het
Chrnb2 A T 3: 89,761,342 V222E probably damaging Het
Cngb3 A T 4: 19,280,960 N10Y possibly damaging Het
Dennd1b A G 1: 139,110,420 K267E Het
Dhx32 A G 7: 133,721,371 Y705H probably damaging Het
Dnah7c G A 1: 46,457,296 V114I probably benign Het
Dnah8 T A 17: 30,741,337 C2229* probably null Het
Gm14401 T C 2: 177,086,456 F112L probably damaging Het
Gm9573 GTGCTGGATTCAGTGGTGGGCAGGGTGGGGGTAGAGCCTGAGCCACTGCTGGATGCAGTGGTGGTCAGGGTGGGTGTAGAGCCTGAGCCA GTGCTGGATGCAGTGGTGGTCAGGGTGGGTGTAGAGCCTGAGCCA 17: 35,620,987 probably benign Het
Habp4 G A 13: 64,174,831 R238H probably benign Het
Herpud1 A G 8: 94,392,521 Y301C probably damaging Het
Itih5 G A 2: 10,241,022 A641T probably benign Het
Kcns3 A T 12: 11,091,845 N284K probably damaging Het
Mcrs1 G A 15: 99,246,933 Q267* probably null Het
Midn G A 10: 80,155,292 A379T probably benign Het
Olfr1028 A T 2: 85,951,512 I150F probably benign Het
Olfr462 A T 11: 87,888,951 probably null Het
Olfr561 T C 7: 102,775,256 V244A probably benign Het
Olfr716 A G 7: 107,147,723 M136V possibly damaging Het
Parpbp T C 10: 88,093,108 D490G probably benign Het
Pcbp2 T A 15: 102,488,276 S262R probably benign Het
Pcdhgc5 T C 18: 37,820,939 I422T possibly damaging Het
Plxna1 G A 6: 89,331,272 R1278W probably damaging Het
Polr1c A G 17: 46,245,048 L162P probably damaging Het
Rasl2-9 A G 7: 5,125,482 S150P probably damaging Het
Raver2 C A 4: 101,102,965 S214* probably null Het
Rec114 T G 9: 58,660,322 E127A possibly damaging Het
Recql5 C A 11: 115,928,112 L209F probably damaging Het
Rgs11 T C 17: 26,204,385 probably null Het
Rgs3 C A 4: 62,690,594 H366N probably damaging Het
Rnf148 C T 6: 23,654,197 D267N possibly damaging Het
Scn1a T C 2: 66,318,213 N1007S probably benign Het
Sdcbp A G 4: 6,393,022 T220A probably benign Het
Sema5a A G 15: 32,548,782 N134S probably benign Het
Smg1 G A 7: 118,206,989 Q210* probably null Het
Snx7 A G 3: 117,832,877 V328A probably benign Het
Sult1c2 A T 17: 53,831,809 S247T probably benign Het
Tceanc2 C T 4: 107,139,800 probably null Het
Tead3 T C 17: 28,335,035 D141G probably benign Het
Tmem136 T A 9: 43,111,553 T169S probably benign Het
Ube3b T C 5: 114,408,209 M692T probably damaging Het
Vmn1r188 T C 13: 22,087,914 F13L probably benign Het
Vmn2r3 A G 3: 64,275,450 V276A possibly damaging Het
Vmn2r57 A G 7: 41,426,759 I443T probably benign Het
Vps33a T C 5: 123,558,675 N305S possibly damaging Het
Wdr34 T C 2: 30,048,718 Q51R probably benign Het
Wdr72 T A 9: 74,143,499 M91K probably benign Het
Xylb T C 9: 119,381,503 F351L probably damaging Het
Zan C T 5: 137,406,352 D3883N unknown Het
Zfp82 T A 7: 30,056,853 H268L probably damaging Het
Other mutations in Olfr869
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Olfr869 APN 9 20137235 missense probably benign
IGL01550:Olfr869 APN 9 20137454 missense probably damaging 0.97
IGL02247:Olfr869 APN 9 20137220 missense probably benign 0.01
IGL02448:Olfr869 APN 9 20137641 nonsense probably null
IGL03076:Olfr869 APN 9 20137727 missense probably benign 0.25
R0045:Olfr869 UTSW 9 20137191 missense probably benign 0.25
R0962:Olfr869 UTSW 9 20137538 missense probably damaging 1.00
R4588:Olfr869 UTSW 9 20138087 makesense probably null
R4931:Olfr869 UTSW 9 20137562 missense probably benign 0.19
R5030:Olfr869 UTSW 9 20138067 missense probably benign 0.01
R5759:Olfr869 UTSW 9 20137932 missense probably benign 0.12
R5780:Olfr869 UTSW 9 20137497 missense probably damaging 0.98
R6440:Olfr869 UTSW 9 20137194 missense probably damaging 1.00
R6599:Olfr869 UTSW 9 20137943 missense probably damaging 1.00
R6710:Olfr869 UTSW 9 20138082 missense probably benign 0.01
R6953:Olfr869 UTSW 9 20138003 missense probably benign 0.00
R7288:Olfr869 UTSW 9 20137441 nonsense probably null
R7585:Olfr869 UTSW 9 20129011
R7860:Olfr869 UTSW 9 20137575 missense probably benign 0.16
R7943:Olfr869 UTSW 9 20137575 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TGCCTAACACAGATGTCCATG -3'
(R):5'- TTGATGGAATTCTCAGGATGGAAG -3'

Sequencing Primer
(F):5'- CCTAACACAGATGTCCATGTTTATAC -3'
(R):5'- GAGGAAATAATTCCTGTGGTT -3'
Posted On2020-01-23