Incidental Mutation 'R8025:Recql5'
ID617661
Institutional Source Beutler Lab
Gene Symbol Recql5
Ensembl Gene ENSMUSG00000020752
Gene NameRecQ protein-like 5
SynonymsRecq5b, Recql5b
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.392) question?
Stock #R8025 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location115892595-115933477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 115928112 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 209 (L209F)
Ref Sequence ENSEMBL: ENSMUSP00000021097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021097] [ENSMUST00000131578] [ENSMUST00000134208] [ENSMUST00000140174]
Predicted Effect probably damaging
Transcript: ENSMUST00000021097
AA Change: L209F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021097
Gene: ENSMUSG00000020752
AA Change: L209F

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
HELICc 274 355 8.68e-22 SMART
Pfam:RecQ_Zn_bind 366 436 1.8e-12 PFAM
low complexity region 472 499 N/A INTRINSIC
PDB:4BK0|B 516 621 2e-51 PDB
Pfam:RecQ5 626 818 3.1e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131578
SMART Domains Protein: ENSMUSP00000136178
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
HELICc 1 82 8.68e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000134208
AA Change: L95F

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137157
Gene: ENSMUSG00000020752
AA Change: L95F

DomainStartEndE-ValueType
Blast:DEXDc 25 96 4e-34 BLAST
HELICc 160 241 8.68e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000140174
AA Change: L209F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136506
Gene: ENSMUSG00000020752
AA Change: L209F

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a helicase that is important for genome stability. The encoded protein also prevents aberrant homologous recombination by displacing RAD51 from ssDNA. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene express elevated levels of sister chromatid exchange due to a failure to suppress crossovers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579G24Rik T G 3: 79,629,328 L51R probably damaging Het
Actl7b T C 4: 56,741,137 T74A probably damaging Het
Aip C A 19: 4,115,346 A207S probably benign Het
AL732309.1 A G 2: 25,246,319 probably benign Het
Apcdd1 G T 18: 62,936,908 C82F probably damaging Het
Arhgap42 T G 9: 9,005,822 I736L probably benign Het
Armc4 A T 18: 7,127,224 N996K probably benign Het
Baz1a A T 12: 54,909,136 I1056N probably benign Het
Bzw2 T C 12: 36,107,518 E316G probably damaging Het
Carns1 A T 19: 4,166,506 I559N probably damaging Het
Ccdc144b C A 3: 36,018,987 R382L probably damaging Het
Chrnb2 A T 3: 89,761,342 V222E probably damaging Het
Cngb3 A T 4: 19,280,960 N10Y possibly damaging Het
Dennd1b A G 1: 139,110,420 K267E Het
Dhx32 A G 7: 133,721,371 Y705H probably damaging Het
Dnah7c G A 1: 46,457,296 V114I probably benign Het
Dnah8 T A 17: 30,741,337 C2229* probably null Het
Gm14401 T C 2: 177,086,456 F112L probably damaging Het
Gm9573 GTGCTGGATTCAGTGGTGGGCAGGGTGGGGGTAGAGCCTGAGCCACTGCTGGATGCAGTGGTGGTCAGGGTGGGTGTAGAGCCTGAGCCA GTGCTGGATGCAGTGGTGGTCAGGGTGGGTGTAGAGCCTGAGCCA 17: 35,620,987 probably benign Het
Habp4 G A 13: 64,174,831 R238H probably benign Het
Herpud1 A G 8: 94,392,521 Y301C probably damaging Het
Itih5 G A 2: 10,241,022 A641T probably benign Het
Kcns3 A T 12: 11,091,845 N284K probably damaging Het
Mcrs1 G A 15: 99,246,933 Q267* probably null Het
Midn G A 10: 80,155,292 A379T probably benign Het
Olfr1028 A T 2: 85,951,512 I150F probably benign Het
Olfr462 A T 11: 87,888,951 probably null Het
Olfr561 T C 7: 102,775,256 V244A probably benign Het
Olfr716 A G 7: 107,147,723 M136V possibly damaging Het
Olfr869 T C 9: 20,137,632 V172A probably benign Het
Parpbp T C 10: 88,093,108 D490G probably benign Het
Pcbp2 T A 15: 102,488,276 S262R probably benign Het
Pcdhgc5 T C 18: 37,820,939 I422T possibly damaging Het
Pcsk5 T A 19: 17,561,051 probably benign Het
Plxna1 G A 6: 89,331,272 R1278W probably damaging Het
Polr1c A G 17: 46,245,048 L162P probably damaging Het
Rasl2-9 A G 7: 5,125,482 S150P probably damaging Het
Raver2 C A 4: 101,102,965 S214* probably null Het
Rbpjl C A 2: 164,410,246 probably benign Het
Rec114 T G 9: 58,660,322 E127A possibly damaging Het
Rgs11 T C 17: 26,204,385 probably null Het
Rgs3 C A 4: 62,690,594 H366N probably damaging Het
Rnf148 C T 6: 23,654,197 D267N possibly damaging Het
Scn1a T C 2: 66,318,213 N1007S probably benign Het
Sdcbp A G 4: 6,393,022 T220A probably benign Het
Sema5a A G 15: 32,548,782 N134S probably benign Het
Smg1 G A 7: 118,206,989 Q210* probably null Het
Snx7 A G 3: 117,832,877 V328A probably benign Het
Sult1c2 A T 17: 53,831,809 S247T probably benign Het
Tceanc2 C T 4: 107,139,800 probably null Het
Tead3 T C 17: 28,335,035 D141G probably benign Het
Tmem136 T A 9: 43,111,553 T169S probably benign Het
Ube3b T C 5: 114,408,209 M692T probably damaging Het
Vmn1r188 T C 13: 22,087,914 F13L probably benign Het
Vmn2r3 A G 3: 64,275,450 V276A possibly damaging Het
Vmn2r57 A G 7: 41,426,759 I443T probably benign Het
Vps33a T C 5: 123,558,675 N305S possibly damaging Het
Vps33b A T 7: 80,290,346 probably benign Het
Wdr34 T C 2: 30,048,718 Q51R probably benign Het
Wdr72 T A 9: 74,143,499 M91K probably benign Het
Xylb T C 9: 119,381,503 F351L probably damaging Het
Zan C T 5: 137,406,352 D3883N unknown Het
Zfp82 T A 7: 30,056,853 H268L probably damaging Het
Other mutations in Recql5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Recql5 APN 11 115897181 missense probably benign 0.04
IGL01589:Recql5 APN 11 115894669 missense probably damaging 1.00
IGL02040:Recql5 APN 11 115932797 missense possibly damaging 0.89
IGL02131:Recql5 APN 11 115923242 missense probably benign 0.01
IGL02198:Recql5 APN 11 115894673 missense probably benign 0.00
IGL02236:Recql5 APN 11 115894030 missense probably benign 0.01
IGL02501:Recql5 APN 11 115895091 missense probably benign 0.26
IGL02980:Recql5 APN 11 115893944 splice site probably null
IGL03028:Recql5 APN 11 115894431 missense possibly damaging 0.94
PIT4581001:Recql5 UTSW 11 115932856 missense possibly damaging 0.53
R0152:Recql5 UTSW 11 115894673 missense probably benign
R0269:Recql5 UTSW 11 115928224 missense possibly damaging 0.91
R0317:Recql5 UTSW 11 115894673 missense probably benign
R0511:Recql5 UTSW 11 115928383 missense probably benign 0.00
R0786:Recql5 UTSW 11 115895802 missense probably benign
R0975:Recql5 UTSW 11 115923256 missense probably damaging 1.00
R1170:Recql5 UTSW 11 115897234 missense probably damaging 0.98
R1208:Recql5 UTSW 11 115893156 missense probably damaging 0.98
R1208:Recql5 UTSW 11 115893156 missense probably damaging 0.98
R1807:Recql5 UTSW 11 115895115 missense possibly damaging 0.63
R1872:Recql5 UTSW 11 115923309 missense probably benign 0.15
R1878:Recql5 UTSW 11 115895101 missense probably benign 0.00
R1935:Recql5 UTSW 11 115897191 missense probably benign 0.00
R1936:Recql5 UTSW 11 115897191 missense probably benign 0.00
R1945:Recql5 UTSW 11 115928297 nonsense probably null
R2011:Recql5 UTSW 11 115897097 missense probably benign 0.20
R2012:Recql5 UTSW 11 115897097 missense probably benign 0.20
R2023:Recql5 UTSW 11 115893640 missense probably benign
R2183:Recql5 UTSW 11 115896787 missense probably benign 0.00
R3881:Recql5 UTSW 11 115893954 missense probably benign
R3881:Recql5 UTSW 11 115893955 missense probably benign 0.00
R4093:Recql5 UTSW 11 115904888 missense probably benign 0.05
R4857:Recql5 UTSW 11 115928212 missense probably damaging 1.00
R5245:Recql5 UTSW 11 115893559 missense probably damaging 1.00
R5323:Recql5 UTSW 11 115927389 missense probably damaging 1.00
R5796:Recql5 UTSW 11 115927865 intron probably benign
R6160:Recql5 UTSW 11 115932787 critical splice donor site probably null
R6229:Recql5 UTSW 11 115930714 missense probably damaging 0.96
R6824:Recql5 UTSW 11 115923212 missense possibly damaging 0.83
R7013:Recql5 UTSW 11 115894576 missense probably benign 0.02
R7043:Recql5 UTSW 11 115930676 critical splice donor site probably null
R7135:Recql5 UTSW 11 115930672 splice site probably null
R7354:Recql5 UTSW 11 115928201 missense probably damaging 1.00
R7373:Recql5 UTSW 11 115928372 missense possibly damaging 0.92
R7503:Recql5 UTSW 11 115895055 missense probably benign 0.00
R7574:Recql5 UTSW 11 115928422 missense probably benign
R7597:Recql5 UTSW 11 115928381 missense probably benign 0.03
R7658:Recql5 UTSW 11 115923276 missense probably damaging 1.00
R8038:Recql5 UTSW 11 115927352 missense possibly damaging 0.90
R8316:Recql5 UTSW 11 115894035 missense possibly damaging 0.46
X0026:Recql5 UTSW 11 115923261 missense probably damaging 1.00
X0028:Recql5 UTSW 11 115894606 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAACTAGGAAACAGTAGCTGTGTC -3'
(R):5'- ATTCCCTGGTGTCCCGAAAC -3'

Sequencing Primer
(F):5'- CAGACAGCATTTTGGACTGC -3'
(R):5'- GAAACCTGCTCTCCTACTTGGTGG -3'
Posted On2020-01-23