Incidental Mutation 'R8026:Olfr48'
ID617689
Institutional Source Beutler Lab
Gene Symbol Olfr48
Ensembl Gene ENSMUSG00000075072
Gene Nameolfactory receptor 48
SynonymsIC3, MOR232-5, GA_x6K02T2Q125-51285881-51284976
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R8026 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location89841793-89848205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89844929 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 15 (N15D)
Ref Sequence ENSEMBL: ENSMUSP00000150505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099762] [ENSMUST00000111520] [ENSMUST00000213833] [ENSMUST00000214428] [ENSMUST00000215613]
Predicted Effect probably benign
Transcript: ENSMUST00000099762
AA Change: N15D

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097350
Gene: ENSMUSG00000075072
AA Change: N15D

DomainStartEndE-ValueType
Pfam:7tm_4 26 299 1e-47 PFAM
Pfam:7tm_1 36 282 8.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111520
SMART Domains Protein: ENSMUSP00000107145
Gene: ENSMUSG00000075073

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.5e-47 PFAM
Pfam:7TM_GPCR_Srsx 33 300 1.1e-5 PFAM
Pfam:7tm_1 39 285 1.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213833
Predicted Effect probably benign
Transcript: ENSMUST00000214428
AA Change: N15D

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000215613
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,406,725 V513A probably damaging Het
Acsf2 C T 11: 94,562,888 V416M probably damaging Het
Adrm1 G A 2: 180,175,209 A225T unknown Het
Aldh9a1 T C 1: 167,352,667 probably null Het
Apbb2 T C 5: 66,451,644 D220G probably benign Het
Bace2 T C 16: 97,436,852 V501A probably benign Het
Camsap1 T C 2: 25,938,202 N1170S probably benign Het
Casr A G 16: 36,495,617 V697A probably damaging Het
Clcn1 T C 6: 42,307,661 probably null Het
Cobl T C 11: 12,253,459 K1081R probably benign Het
Ctr9 T A 7: 111,033,892 L116I probably damaging Het
Dennd4a T C 9: 64,873,030 F616S probably damaging Het
Dynlt1a C T 17: 6,311,814 G30S possibly damaging Het
Eif1 T C 11: 100,320,448 S23P possibly damaging Het
Eml6 A C 11: 29,749,973 L1721R possibly damaging Het
Fscb A G 12: 64,474,275 I139T probably benign Het
Fstl4 A G 11: 53,068,669 E179G probably damaging Het
Fuom T C 7: 140,100,154 T95A Het
Gigyf1 C T 5: 137,525,478 H1001Y probably damaging Het
Gm21886 T A 18: 80,089,746 S66C probably damaging Het
Helz2 G A 2: 181,240,205 T265I probably benign Het
Hs6st3 G T 14: 119,869,556 V459F probably damaging Het
Ido2 A G 8: 24,535,140 probably null Het
Idua A G 5: 108,670,249 I96V probably benign Het
Ifi207 CTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG CTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG 1: 173,729,196 probably benign Het
Inpp5j A G 11: 3,495,171 S494P Het
Krt19 A G 11: 100,141,383 V285A probably damaging Het
Krt71 T G 15: 101,738,382 D297A possibly damaging Het
L3hypdh G A 12: 72,084,949 R70C probably damaging Het
Masp1 T C 16: 23,484,406 Y324C probably damaging Het
Mfap2 A G 4: 141,013,803 D25G possibly damaging Het
Mmp17 G A 5: 129,595,084 probably null Het
Mroh7 G A 4: 106,721,437 P15S probably benign Het
Muc5b T A 7: 141,863,636 C3440S probably benign Het
Naip5 C A 13: 100,245,898 S101I probably damaging Het
Neb A T 2: 52,223,048 Y1066N Het
Nop56 T A 2: 130,277,268 C38S probably benign Het
Nup214 T A 2: 32,033,350 L1297Q possibly damaging Het
Olfr1242 A G 2: 89,493,788 F175L probably damaging Het
Olfr192 T C 16: 59,098,368 H208R unknown Het
Olfr66 A G 7: 103,881,697 V182A possibly damaging Het
Olfr68 T A 7: 103,778,340 I2F probably benign Het
Olfr967 T C 9: 39,750,796 S137P possibly damaging Het
Pacrg C T 17: 10,576,567 V155I probably benign Het
Patz1 A T 11: 3,307,658 M96L probably benign Het
Pcca A G 14: 122,638,382 D141G probably benign Het
Ptprr A G 10: 116,048,170 Y44C probably damaging Het
Rad51ap1 A G 6: 126,934,712 probably null Het
Raet1e A C 10: 22,181,299 D174A probably damaging Het
Rhobtb2 T G 14: 69,796,765 D337A probably benign Het
Sbf2 T C 7: 110,335,387 K1377E probably damaging Het
Sh3pxd2b A G 11: 32,411,567 K260E probably damaging Het
Slc4a8 A T 15: 100,787,289 I234F possibly damaging Het
Srgap3 C T 6: 112,739,364 R625H probably benign Het
Tbxas1 C T 6: 39,027,896 T359I probably benign Het
Trim9 T A 12: 70,290,387 S309C probably benign Het
Ttn G A 2: 76,829,139 P12191S unknown Het
Unc80 A G 1: 66,483,304 R222G possibly damaging Het
Vmn1r202 A T 13: 22,502,144 H34Q possibly damaging Het
Vmn2r61 T A 7: 42,266,717 N251K probably benign Het
Vmn2r67 A T 7: 85,136,716 Y694N probably damaging Het
Vwde A G 6: 13,205,783 F255S probably benign Het
Zfp532 T G 18: 65,625,156 I720R possibly damaging Het
Zfp819 A G 7: 43,617,895 T601A probably benign Het
Zfp853 G T 5: 143,288,525 Q462K unknown Het
Other mutations in Olfr48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01661:Olfr48 APN 2 89844095 missense probably benign 0.00
IGL02184:Olfr48 APN 2 89844385 missense probably damaging 0.98
IGL02408:Olfr48 APN 2 89844971 start codon destroyed probably benign 0.04
IGL02437:Olfr48 APN 2 89844784 missense probably damaging 0.98
IGL02985:Olfr48 APN 2 89844340 missense possibly damaging 0.66
IGL03230:Olfr48 APN 2 89844113 missense probably benign
IGL03393:Olfr48 APN 2 89844569 missense probably benign 0.00
R0482:Olfr48 UTSW 2 89844169 missense probably benign 0.20
R0555:Olfr48 UTSW 2 89844443 missense probably benign 0.00
R1268:Olfr48 UTSW 2 89844154 missense probably damaging 0.98
R1617:Olfr48 UTSW 2 89844254 missense probably benign 0.03
R3552:Olfr48 UTSW 2 89844343 missense possibly damaging 0.53
R4172:Olfr48 UTSW 2 89844778 missense probably damaging 1.00
R4173:Olfr48 UTSW 2 89844778 missense probably damaging 1.00
R4174:Olfr48 UTSW 2 89844778 missense probably damaging 1.00
R5540:Olfr48 UTSW 2 89844667 missense probably damaging 1.00
R5909:Olfr48 UTSW 2 89844391 missense possibly damaging 0.89
R5941:Olfr48 UTSW 2 89844515 missense probably benign 0.07
R7425:Olfr48 UTSW 2 89844445 missense probably damaging 0.99
R7445:Olfr48 UTSW 2 89844272 missense probably damaging 0.99
R7660:Olfr48 UTSW 2 89844443 missense probably benign 0.00
R7996:Olfr48 UTSW 2 89844415 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- AGCATCTTAGGAGTCATGGACG -3'
(R):5'- ACGGATTGGTTCTTCAATTTTCCTG -3'

Sequencing Primer
(F):5'- GAGGAGCAGCAGCCATCTATC -3'
(R):5'- GAAATCTGACCATGTGCATCTC -3'
Posted On2020-01-23