Incidental Mutation 'R8026:Tbxas1'
ID617702
Institutional Source Beutler Lab
Gene Symbol Tbxas1
Ensembl Gene ENSMUSG00000029925
Gene Namethromboxane A synthase 1, platelet
SynonymsTXAS, TXS, CYP5A1, CYP5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R8026 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location38875404-39084585 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 39027896 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 359 (T359I)
Ref Sequence ENSEMBL: ENSMUSP00000003017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003017]
Predicted Effect probably benign
Transcript: ENSMUST00000003017
AA Change: T359I

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000003017
Gene: ENSMUSG00000029925
AA Change: T359I

DomainStartEndE-ValueType
low complexity region 16 28 N/A INTRINSIC
Pfam:p450 44 530 1.5e-95 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. However, this protein is considered a member of the cytochrome P450 superfamily on the basis of sequence similarity rather than functional similarity. This endoplasmic reticulum membrane protein catalyzes the conversion of prostglandin H2 to thromboxane A2, a potent vasoconstrictor and inducer of platelet aggregation. The enzyme plays a role in several pathophysiological processes including hemostasis, cardiovascular disease, and stroke. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous null mice display increased bleeding time and decreased platelet response to arachidonic acid. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,406,725 V513A probably damaging Het
Acsf2 C T 11: 94,562,888 V416M probably damaging Het
Adrm1 G A 2: 180,175,209 A225T unknown Het
Aldh9a1 T C 1: 167,352,667 probably null Het
Apbb2 T C 5: 66,451,644 D220G probably benign Het
B230118H07Rik A T 2: 101,570,644 probably benign Het
Bace2 T C 16: 97,436,852 V501A probably benign Het
Camsap1 T C 2: 25,938,202 N1170S probably benign Het
Casr A G 16: 36,495,617 V697A probably damaging Het
Clcn1 T C 6: 42,307,661 probably null Het
Cobl T C 11: 12,253,459 K1081R probably benign Het
Ctr9 T A 7: 111,033,892 L116I probably damaging Het
Dennd4a T C 9: 64,873,030 F616S probably damaging Het
Dynlt1a C T 17: 6,311,814 G30S possibly damaging Het
Eif1 T C 11: 100,320,448 S23P possibly damaging Het
Eml6 A C 11: 29,749,973 L1721R possibly damaging Het
Fscb A G 12: 64,474,275 I139T probably benign Het
Fstl4 A G 11: 53,068,669 E179G probably damaging Het
Fuom T C 7: 140,100,154 T95A Het
Gigyf1 C T 5: 137,525,478 H1001Y probably damaging Het
Gm21886 T A 18: 80,089,746 S66C probably damaging Het
Helz2 G A 2: 181,240,205 T265I probably benign Het
Hs6st3 G T 14: 119,869,556 V459F probably damaging Het
Ido2 A G 8: 24,535,140 probably null Het
Idua A G 5: 108,670,249 I96V probably benign Het
Inpp5j A G 11: 3,495,171 S494P Het
Krt19 A G 11: 100,141,383 V285A probably damaging Het
Krt71 T G 15: 101,738,382 D297A possibly damaging Het
L3hypdh G A 12: 72,084,949 R70C probably damaging Het
Masp1 T C 16: 23,484,406 Y324C probably damaging Het
Mfap2 A G 4: 141,013,803 D25G possibly damaging Het
Mmp17 G A 5: 129,595,084 probably null Het
Mroh7 G A 4: 106,721,437 P15S probably benign Het
Muc5b T A 7: 141,863,636 C3440S probably benign Het
Naip5 C A 13: 100,245,898 S101I probably damaging Het
Neb A T 2: 52,223,048 Y1066N Het
Nop56 T A 2: 130,277,268 C38S probably benign Het
Nup214 T A 2: 32,033,350 L1297Q possibly damaging Het
Oasl2 C A 5: 114,902,268 probably benign Het
Olfr1242 A G 2: 89,493,788 F175L probably damaging Het
Olfr192 T C 16: 59,098,368 H208R unknown Het
Olfr48 T C 2: 89,844,929 N15D probably benign Het
Olfr66 A G 7: 103,881,697 V182A possibly damaging Het
Olfr68 T A 7: 103,778,340 I2F probably benign Het
Olfr967 T C 9: 39,750,796 S137P possibly damaging Het
Pacrg C T 17: 10,576,567 V155I probably benign Het
Patz1 A T 11: 3,307,658 M96L probably benign Het
Pcca A G 14: 122,638,382 D141G probably benign Het
Ptprr A G 10: 116,048,170 Y44C probably damaging Het
Rad51ap1 A G 6: 126,934,712 probably null Het
Raet1e A C 10: 22,181,299 D174A probably damaging Het
Rhobtb2 T G 14: 69,796,765 D337A probably benign Het
Sbf2 T C 7: 110,335,387 K1377E probably damaging Het
Sh3pxd2b A G 11: 32,411,567 K260E probably damaging Het
Slc4a8 A T 15: 100,787,289 I234F possibly damaging Het
Srgap3 C T 6: 112,739,364 R625H probably benign Het
Trim9 T A 12: 70,290,387 S309C probably benign Het
Ttn G A 2: 76,829,139 P12191S unknown Het
Unc80 A G 1: 66,483,304 R222G possibly damaging Het
Vmn1r202 A T 13: 22,502,144 H34Q possibly damaging Het
Vmn2r61 T A 7: 42,266,717 N251K probably benign Het
Vmn2r67 A T 7: 85,136,716 Y694N probably damaging Het
Vwde A G 6: 13,205,783 F255S probably benign Het
Zfp532 T G 18: 65,625,156 I720R possibly damaging Het
Zfp819 A G 7: 43,617,895 T601A probably benign Het
Zfp853 G T 5: 143,288,525 Q462K unknown Het
Other mutations in Tbxas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Tbxas1 APN 6 39021181 missense probably damaging 0.97
IGL01319:Tbxas1 APN 6 39017973 missense probably benign 0.09
IGL01633:Tbxas1 APN 6 38982191 missense probably benign 0.00
IGL01712:Tbxas1 APN 6 39081060 missense probably benign 0.00
IGL01860:Tbxas1 APN 6 38948627 missense probably damaging 1.00
IGL01964:Tbxas1 APN 6 39083814 missense probably benign 0.00
IGL02036:Tbxas1 APN 6 39021157 missense probably benign
IGL02335:Tbxas1 APN 6 39023080 missense probably damaging 1.00
IGL02615:Tbxas1 APN 6 39027866 missense probably damaging 1.00
R0245:Tbxas1 UTSW 6 39027768 missense probably benign 0.00
R1677:Tbxas1 UTSW 6 39017888 splice site probably benign
R1975:Tbxas1 UTSW 6 38948641 splice site probably benign
R1977:Tbxas1 UTSW 6 38948641 splice site probably benign
R2308:Tbxas1 UTSW 6 39027661 missense probably benign 0.08
R4394:Tbxas1 UTSW 6 39027779 missense probably benign 0.19
R4702:Tbxas1 UTSW 6 39083857 critical splice donor site probably null
R4703:Tbxas1 UTSW 6 39083857 critical splice donor site probably null
R4705:Tbxas1 UTSW 6 39083857 critical splice donor site probably null
R4935:Tbxas1 UTSW 6 39023047 missense probably benign 0.02
R5424:Tbxas1 UTSW 6 39027905 missense possibly damaging 0.72
R5704:Tbxas1 UTSW 6 39021133 missense probably benign 0.20
R6358:Tbxas1 UTSW 6 38952112 intron probably benign
R6455:Tbxas1 UTSW 6 38952145 intron probably benign
R6823:Tbxas1 UTSW 6 38919153 start codon destroyed possibly damaging 0.94
R6868:Tbxas1 UTSW 6 39084306 missense probably damaging 1.00
R6888:Tbxas1 UTSW 6 38952074 intron probably benign
R7500:Tbxas1 UTSW 6 38982212 nonsense probably null
R8351:Tbxas1 UTSW 6 39027916 missense possibly damaging 0.67
R8729:Tbxas1 UTSW 6 39001338 missense probably benign 0.33
R8837:Tbxas1 UTSW 6 39071430 missense
Z1177:Tbxas1 UTSW 6 39021104 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGGTCCCAGAATCCCTGTC -3'
(R):5'- TTTACTTGCTTGCCCAGAGAGC -3'

Sequencing Primer
(F):5'- GTCCTCTTCTGAGTGCACAAAGG -3'
(R):5'- TTGCTTGCCCAGAGAGCTAGAG -3'
Posted On2020-01-23