Incidental Mutation 'R8026:Clcn1'
ID617703
Institutional Source Beutler Lab
Gene Symbol Clcn1
Ensembl Gene ENSMUSG00000029862
Gene Namechloride channel, voltage-sensitive 1
SynonymsClc1, SMCC1, nmf355, NMF355, Clc-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8026 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location42286685-42315756 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 42307661 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031894] [ENSMUST00000164091] [ENSMUST00000168660]
Predicted Effect probably null
Transcript: ENSMUST00000031894
SMART Domains Protein: ENSMUSP00000031894
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 572 3.2e-87 PFAM
Blast:CBS 612 662 1e-24 BLAST
low complexity region 723 747 N/A INTRINSIC
Blast:CBS 830 877 4e-19 BLAST
low complexity region 928 950 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163235
SMART Domains Protein: ENSMUSP00000132387
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 12 36 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163936
SMART Domains Protein: ENSMUSP00000130148
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 1.2e-27 PFAM
Pfam:Voltage_CLC 258 501 3.9e-44 PFAM
PDB:2D4Z|B 520 807 2e-47 PDB
Blast:CBS 541 591 2e-24 BLAST
Blast:CBS 759 806 3e-19 BLAST
low complexity region 857 879 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164091
SMART Domains Protein: ENSMUSP00000131354
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 256 2.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165780
SMART Domains Protein: ENSMUSP00000130550
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 227 9.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168660
SMART Domains Protein: ENSMUSP00000126045
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 88 97 N/A INTRINSIC
Pfam:Voltage_CLC 136 257 1.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169024
SMART Domains Protein: ENSMUSP00000130968
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 2.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170028
SMART Domains Protein: ENSMUSP00000132154
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 235 8e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. The protein encoded by this gene regulates the electric excitability of the skeletal muscle membrane. Mutations in this gene cause two forms of inherited human muscle disorders: recessive generalized myotonia congenita (Becker) and dominant myotonia (Thomsen). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mutant mice exhibit mild to severe spasms of the hind limbs and abnormal hind limb reflexes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,406,725 V513A probably damaging Het
Acsf2 C T 11: 94,562,888 V416M probably damaging Het
Adrm1 G A 2: 180,175,209 A225T unknown Het
Aldh9a1 T C 1: 167,352,667 probably null Het
Apbb2 T C 5: 66,451,644 D220G probably benign Het
B230118H07Rik A T 2: 101,570,644 probably benign Het
Bace2 T C 16: 97,436,852 V501A probably benign Het
Camsap1 T C 2: 25,938,202 N1170S probably benign Het
Casr A G 16: 36,495,617 V697A probably damaging Het
Cobl T C 11: 12,253,459 K1081R probably benign Het
Ctr9 T A 7: 111,033,892 L116I probably damaging Het
Dennd4a T C 9: 64,873,030 F616S probably damaging Het
Dynlt1a C T 17: 6,311,814 G30S possibly damaging Het
Eif1 T C 11: 100,320,448 S23P possibly damaging Het
Eml6 A C 11: 29,749,973 L1721R possibly damaging Het
Fscb A G 12: 64,474,275 I139T probably benign Het
Fstl4 A G 11: 53,068,669 E179G probably damaging Het
Fuom T C 7: 140,100,154 T95A Het
Gigyf1 C T 5: 137,525,478 H1001Y probably damaging Het
Gm21886 T A 18: 80,089,746 S66C probably damaging Het
Helz2 G A 2: 181,240,205 T265I probably benign Het
Hs6st3 G T 14: 119,869,556 V459F probably damaging Het
Ido2 A G 8: 24,535,140 probably null Het
Idua A G 5: 108,670,249 I96V probably benign Het
Inpp5j A G 11: 3,495,171 S494P Het
Krt19 A G 11: 100,141,383 V285A probably damaging Het
Krt71 T G 15: 101,738,382 D297A possibly damaging Het
L3hypdh G A 12: 72,084,949 R70C probably damaging Het
Masp1 T C 16: 23,484,406 Y324C probably damaging Het
Mfap2 A G 4: 141,013,803 D25G possibly damaging Het
Mmp17 G A 5: 129,595,084 probably null Het
Mroh7 G A 4: 106,721,437 P15S probably benign Het
Muc5b T A 7: 141,863,636 C3440S probably benign Het
Naip5 C A 13: 100,245,898 S101I probably damaging Het
Neb A T 2: 52,223,048 Y1066N Het
Nop56 T A 2: 130,277,268 C38S probably benign Het
Nup214 T A 2: 32,033,350 L1297Q possibly damaging Het
Oasl2 C A 5: 114,902,268 probably benign Het
Olfr1242 A G 2: 89,493,788 F175L probably damaging Het
Olfr192 T C 16: 59,098,368 H208R unknown Het
Olfr48 T C 2: 89,844,929 N15D probably benign Het
Olfr66 A G 7: 103,881,697 V182A possibly damaging Het
Olfr68 T A 7: 103,778,340 I2F probably benign Het
Olfr967 T C 9: 39,750,796 S137P possibly damaging Het
Pacrg C T 17: 10,576,567 V155I probably benign Het
Patz1 A T 11: 3,307,658 M96L probably benign Het
Pcca A G 14: 122,638,382 D141G probably benign Het
Ptprr A G 10: 116,048,170 Y44C probably damaging Het
Rad51ap1 A G 6: 126,934,712 probably null Het
Raet1e A C 10: 22,181,299 D174A probably damaging Het
Rhobtb2 T G 14: 69,796,765 D337A probably benign Het
Sbf2 T C 7: 110,335,387 K1377E probably damaging Het
Sh3pxd2b A G 11: 32,411,567 K260E probably damaging Het
Slc4a8 A T 15: 100,787,289 I234F possibly damaging Het
Srgap3 C T 6: 112,739,364 R625H probably benign Het
Tbxas1 C T 6: 39,027,896 T359I probably benign Het
Trim9 T A 12: 70,290,387 S309C probably benign Het
Ttn G A 2: 76,829,139 P12191S unknown Het
Unc80 A G 1: 66,483,304 R222G possibly damaging Het
Vmn1r202 A T 13: 22,502,144 H34Q possibly damaging Het
Vmn2r61 T A 7: 42,266,717 N251K probably benign Het
Vmn2r67 A T 7: 85,136,716 Y694N probably damaging Het
Vwde A G 6: 13,205,783 F255S probably benign Het
Zfp532 T G 18: 65,625,156 I720R possibly damaging Het
Zfp819 A G 7: 43,617,895 T601A probably benign Het
Zfp853 G T 5: 143,288,525 Q462K unknown Het
Other mutations in Clcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Clcn1 APN 6 42291703 missense probably damaging 1.00
IGL01732:Clcn1 APN 6 42310672 splice site probably benign
IGL02055:Clcn1 APN 6 42307555 missense probably damaging 1.00
IGL02507:Clcn1 APN 6 42307073 splice site probably benign
IGL02649:Clcn1 APN 6 42298829 missense probably damaging 1.00
IGL02739:Clcn1 APN 6 42286780 splice site probably null
IGL03148:Clcn1 APN 6 42299991 critical splice donor site probably null
IGL03190:Clcn1 APN 6 42290103 missense probably benign 0.02
IGL03327:Clcn1 APN 6 42311219 missense probably benign 0.00
IGL03346:Clcn1 APN 6 42311219 missense probably benign 0.00
Faint UTSW 6 42307265 missense probably damaging 1.00
jack_spratt UTSW 6 42310581 missense probably benign
Limitations UTSW 6 42310063 missense possibly damaging 0.79
maimed UTSW 6 42298820 missense probably damaging 1.00
R0167:Clcn1 UTSW 6 42286836 missense probably damaging 1.00
R0323:Clcn1 UTSW 6 42310140 missense probably damaging 0.99
R0491:Clcn1 UTSW 6 42310581 missense probably benign
R0573:Clcn1 UTSW 6 42313045 splice site probably null
R0615:Clcn1 UTSW 6 42305575 missense probably damaging 1.00
R0944:Clcn1 UTSW 6 42313141 missense probably benign 0.00
R1562:Clcn1 UTSW 6 42300235 missense probably benign 0.29
R1566:Clcn1 UTSW 6 42291440 missense possibly damaging 0.58
R1692:Clcn1 UTSW 6 42313098 missense possibly damaging 0.67
R1728:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1729:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1772:Clcn1 UTSW 6 42294145 missense probably damaging 1.00
R1784:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1793:Clcn1 UTSW 6 42298926 critical splice donor site probably null
R1861:Clcn1 UTSW 6 42313991 missense possibly damaging 0.63
R1864:Clcn1 UTSW 6 42305541 missense probably damaging 1.00
R1865:Clcn1 UTSW 6 42305541 missense probably damaging 1.00
R2356:Clcn1 UTSW 6 42291625 missense probably damaging 1.00
R2403:Clcn1 UTSW 6 42313112 missense probably damaging 0.99
R2987:Clcn1 UTSW 6 42298850 missense probably damaging 1.00
R3082:Clcn1 UTSW 6 42290178 missense probably damaging 0.98
R3500:Clcn1 UTSW 6 42292995 missense probably damaging 0.99
R3747:Clcn1 UTSW 6 42299915 missense probably damaging 1.00
R3748:Clcn1 UTSW 6 42299915 missense probably damaging 1.00
R4041:Clcn1 UTSW 6 42309968 missense probably damaging 1.00
R4749:Clcn1 UTSW 6 42290197 splice site probably null
R4836:Clcn1 UTSW 6 42309964 missense probably damaging 0.96
R5021:Clcn1 UTSW 6 42310988 nonsense probably null
R5085:Clcn1 UTSW 6 42313880 missense probably benign 0.41
R5528:Clcn1 UTSW 6 42300341 missense probably benign 0.01
R5628:Clcn1 UTSW 6 42298889 missense probably damaging 0.96
R5678:Clcn1 UTSW 6 42307265 missense probably damaging 1.00
R5943:Clcn1 UTSW 6 42292966 missense probably damaging 1.00
R6053:Clcn1 UTSW 6 42300274 nonsense probably null
R6175:Clcn1 UTSW 6 42314162 missense probably damaging 1.00
R6394:Clcn1 UTSW 6 42307590 missense possibly damaging 0.84
R6394:Clcn1 UTSW 6 42313238 missense possibly damaging 0.82
R7012:Clcn1 UTSW 6 42290608 missense probably benign 0.01
R7020:Clcn1 UTSW 6 42298820 missense probably damaging 1.00
R7048:Clcn1 UTSW 6 42307543 missense probably damaging 1.00
R7212:Clcn1 UTSW 6 42291389 missense possibly damaging 0.46
R7225:Clcn1 UTSW 6 42293462 missense probably damaging 1.00
R7264:Clcn1 UTSW 6 42298838 missense probably damaging 1.00
R7636:Clcn1 UTSW 6 42291334 nonsense probably null
R7663:Clcn1 UTSW 6 42310063 missense possibly damaging 0.79
R7807:Clcn1 UTSW 6 42310348 splice site probably null
R7954:Clcn1 UTSW 6 42286691 unclassified probably benign
R8045:Clcn1 UTSW 6 42290694 missense probably damaging 1.00
R8499:Clcn1 UTSW 6 42307199 missense probably damaging 1.00
R8523:Clcn1 UTSW 6 42307589 nonsense probably null
Z1088:Clcn1 UTSW 6 42300360 missense probably benign 0.40
Z1088:Clcn1 UTSW 6 42307256 missense probably damaging 1.00
Z1176:Clcn1 UTSW 6 42307567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGGCAGACTTTGTGGGAAG -3'
(R):5'- TAGCTCTGAGTTCAAGTCCATACC -3'

Sequencing Primer
(F):5'- CCAGCATAGGCCAAGAGTG -3'
(R):5'- AGTCCATACCTGCAATGGTG -3'
Posted On2020-01-23