Incidental Mutation 'R8026:Sbf2'
ID617711
Institutional Source Beutler Lab
Gene Symbol Sbf2
Ensembl Gene ENSMUSG00000038371
Gene NameSET binding factor 2
SynonymsmMTMH1, 4833411B01Rik, Mtmr13, B430219L04Rik, SBF2
MMRRC Submission
Accession Numbers

Genbank: NM_177324; MGI: 1921831

Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R8026 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location110308013-110614922 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110335387 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1377 (K1377E)
Ref Sequence ENSEMBL: ENSMUSP00000033058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033058] [ENSMUST00000164759] [ENSMUST00000166020]
Predicted Effect probably damaging
Transcript: ENSMUST00000033058
AA Change: K1377E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033058
Gene: ENSMUSG00000038371
AA Change: K1377E

DomainStartEndE-ValueType
uDENN 1 87 2.27e-33 SMART
DENN 116 298 5.68e-75 SMART
dDENN 351 420 2e-20 SMART
Pfam:SBF2 530 752 3.3e-106 PFAM
GRAM 869 955 1.3e-12 SMART
low complexity region 1078 1089 N/A INTRINSIC
Pfam:Myotub-related 1091 1544 8.3e-86 PFAM
PH 1767 1872 3.05e-18 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000131927
Gene: ENSMUSG00000038371
AA Change: K269E

DomainStartEndE-ValueType
Pfam:Myotub-related 1 339 1.9e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164759
AA Change: K1352E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132072
Gene: ENSMUSG00000038371
AA Change: K1352E

DomainStartEndE-ValueType
uDENN 1 87 2.27e-33 SMART
DENN 116 298 5.68e-75 SMART
dDENN 351 420 2e-20 SMART
Pfam:SBF2 528 752 1.6e-107 PFAM
GRAM 869 955 1.3e-12 SMART
Pfam:Myotub-related 1089 1521 1.6e-98 PFAM
PH 1742 1847 3.05e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166020
AA Change: K1331E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126217
Gene: ENSMUSG00000038371
AA Change: K1331E

DomainStartEndE-ValueType
uDENN 1 75 9.26e-1 SMART
DENN 70 252 5.68e-75 SMART
dDENN 305 374 2e-20 SMART
Pfam:SBF2 482 706 1.6e-107 PFAM
GRAM 823 909 1.3e-12 SMART
Pfam:Myotub-related 1043 1500 5.9e-98 PFAM
PH 1721 1826 3.05e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pseudophosphatase and member of the myotubularin-related protein family. This gene maps within the CMT4B2 candidate region of chromosome 11p15 and mutations in this gene have been associated with Charcot-Marie-Tooth Disease, type 4B2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null alleles display progressive misfolding of myelin sheaths and abnormal nerve electrophysiology. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,406,725 V513A probably damaging Het
Acsf2 C T 11: 94,562,888 V416M probably damaging Het
Adrm1 G A 2: 180,175,209 A225T unknown Het
Aldh9a1 T C 1: 167,352,667 probably null Het
Apbb2 T C 5: 66,451,644 D220G probably benign Het
B230118H07Rik A T 2: 101,570,644 probably benign Het
Bace2 T C 16: 97,436,852 V501A probably benign Het
Camsap1 T C 2: 25,938,202 N1170S probably benign Het
Casr A G 16: 36,495,617 V697A probably damaging Het
Clcn1 T C 6: 42,307,661 probably null Het
Cobl T C 11: 12,253,459 K1081R probably benign Het
Ctr9 T A 7: 111,033,892 L116I probably damaging Het
Dennd4a T C 9: 64,873,030 F616S probably damaging Het
Dynlt1a C T 17: 6,311,814 G30S possibly damaging Het
Eif1 T C 11: 100,320,448 S23P possibly damaging Het
Eml6 A C 11: 29,749,973 L1721R possibly damaging Het
Fscb A G 12: 64,474,275 I139T probably benign Het
Fstl4 A G 11: 53,068,669 E179G probably damaging Het
Fuom T C 7: 140,100,154 T95A Het
Gigyf1 C T 5: 137,525,478 H1001Y probably damaging Het
Gm21886 T A 18: 80,089,746 S66C probably damaging Het
Helz2 G A 2: 181,240,205 T265I probably benign Het
Hs6st3 G T 14: 119,869,556 V459F probably damaging Het
Ido2 A G 8: 24,535,140 probably null Het
Idua A G 5: 108,670,249 I96V probably benign Het
Inpp5j A G 11: 3,495,171 S494P Het
Krt19 A G 11: 100,141,383 V285A probably damaging Het
Krt71 T G 15: 101,738,382 D297A possibly damaging Het
L3hypdh G A 12: 72,084,949 R70C probably damaging Het
Masp1 T C 16: 23,484,406 Y324C probably damaging Het
Mfap2 A G 4: 141,013,803 D25G possibly damaging Het
Mmp17 G A 5: 129,595,084 probably null Het
Mroh7 G A 4: 106,721,437 P15S probably benign Het
Muc5b T A 7: 141,863,636 C3440S probably benign Het
Naip5 C A 13: 100,245,898 S101I probably damaging Het
Neb A T 2: 52,223,048 Y1066N Het
Nop56 T A 2: 130,277,268 C38S probably benign Het
Nup214 T A 2: 32,033,350 L1297Q possibly damaging Het
Oasl2 C A 5: 114,902,268 probably benign Het
Olfr1242 A G 2: 89,493,788 F175L probably damaging Het
Olfr192 T C 16: 59,098,368 H208R unknown Het
Olfr48 T C 2: 89,844,929 N15D probably benign Het
Olfr66 A G 7: 103,881,697 V182A possibly damaging Het
Olfr68 T A 7: 103,778,340 I2F probably benign Het
Olfr967 T C 9: 39,750,796 S137P possibly damaging Het
Pacrg C T 17: 10,576,567 V155I probably benign Het
Patz1 A T 11: 3,307,658 M96L probably benign Het
Pcca A G 14: 122,638,382 D141G probably benign Het
Ptprr A G 10: 116,048,170 Y44C probably damaging Het
Rad51ap1 A G 6: 126,934,712 probably null Het
Raet1e A C 10: 22,181,299 D174A probably damaging Het
Rhobtb2 T G 14: 69,796,765 D337A probably benign Het
Sh3pxd2b A G 11: 32,411,567 K260E probably damaging Het
Slc4a8 A T 15: 100,787,289 I234F possibly damaging Het
Srgap3 C T 6: 112,739,364 R625H probably benign Het
Tbxas1 C T 6: 39,027,896 T359I probably benign Het
Trim9 T A 12: 70,290,387 S309C probably benign Het
Ttn G A 2: 76,829,139 P12191S unknown Het
Unc80 A G 1: 66,483,304 R222G possibly damaging Het
Vmn1r202 A T 13: 22,502,144 H34Q possibly damaging Het
Vmn2r61 T A 7: 42,266,717 N251K probably benign Het
Vmn2r67 A T 7: 85,136,716 Y694N probably damaging Het
Vwde A G 6: 13,205,783 F255S probably benign Het
Zfp532 T G 18: 65,625,156 I720R possibly damaging Het
Zfp819 A G 7: 43,617,895 T601A probably benign Het
Zfp853 G T 5: 143,288,525 Q462K unknown Het
Other mutations in Sbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Sbf2 APN 7 110375832 splice site probably benign
IGL01089:Sbf2 APN 7 110348962 missense probably damaging 1.00
IGL01144:Sbf2 APN 7 110329903 missense probably damaging 1.00
IGL01652:Sbf2 APN 7 110447120 missense probably damaging 1.00
IGL01950:Sbf2 APN 7 110365825 missense probably benign 0.00
IGL02027:Sbf2 APN 7 110461141 missense probably damaging 1.00
IGL02244:Sbf2 APN 7 110560295 missense probably damaging 1.00
IGL02376:Sbf2 APN 7 110462956 missense probably damaging 0.99
IGL03405:Sbf2 APN 7 110462932 missense probably damaging 0.98
N/A - 535:Sbf2 UTSW 7 110312752 missense probably benign
R0084:Sbf2 UTSW 7 110442366 missense possibly damaging 0.95
R0092:Sbf2 UTSW 7 110320806 splice site probably benign
R0121:Sbf2 UTSW 7 110489219 critical splice donor site probably null
R0464:Sbf2 UTSW 7 110464576 splice site probably benign
R0505:Sbf2 UTSW 7 110399343 missense probably damaging 1.00
R0531:Sbf2 UTSW 7 110367323 splice site probably benign
R0554:Sbf2 UTSW 7 110428287 missense probably damaging 1.00
R0617:Sbf2 UTSW 7 110330683 frame shift probably null
R0619:Sbf2 UTSW 7 110310262 missense possibly damaging 0.87
R0799:Sbf2 UTSW 7 110341355 missense possibly damaging 0.58
R0898:Sbf2 UTSW 7 110371652 missense possibly damaging 0.59
R1077:Sbf2 UTSW 7 110367172 splice site probably benign
R1167:Sbf2 UTSW 7 110364549 missense probably damaging 1.00
R1169:Sbf2 UTSW 7 110310184 missense probably benign 0.04
R1424:Sbf2 UTSW 7 110315026 missense probably damaging 1.00
R1536:Sbf2 UTSW 7 110378043 missense probably damaging 1.00
R1558:Sbf2 UTSW 7 110428346 missense probably damaging 1.00
R1601:Sbf2 UTSW 7 110340076 critical splice acceptor site probably null
R1762:Sbf2 UTSW 7 110312758 missense probably benign
R1771:Sbf2 UTSW 7 110461146 nonsense probably null
R1989:Sbf2 UTSW 7 110348923 missense possibly damaging 0.94
R2109:Sbf2 UTSW 7 110461212 missense probably damaging 1.00
R2126:Sbf2 UTSW 7 110560295 missense probably damaging 1.00
R2444:Sbf2 UTSW 7 110330698 missense probably benign 0.31
R3765:Sbf2 UTSW 7 110375581 missense probably damaging 1.00
R3808:Sbf2 UTSW 7 110489280 makesense probably null
R3895:Sbf2 UTSW 7 110447091 missense probably damaging 0.99
R3978:Sbf2 UTSW 7 110329885 missense probably benign 0.00
R4056:Sbf2 UTSW 7 110441466 missense probably damaging 0.99
R4057:Sbf2 UTSW 7 110441466 missense probably damaging 0.99
R4111:Sbf2 UTSW 7 110428242 missense probably damaging 1.00
R4569:Sbf2 UTSW 7 110348853 critical splice donor site probably null
R4670:Sbf2 UTSW 7 110335399 missense probably damaging 1.00
R4763:Sbf2 UTSW 7 110420917 missense probably damaging 1.00
R4792:Sbf2 UTSW 7 110351610 missense probably damaging 0.98
R4811:Sbf2 UTSW 7 110372535 missense probably damaging 1.00
R4822:Sbf2 UTSW 7 110377939 intron probably benign
R5110:Sbf2 UTSW 7 110364657 missense probably benign 0.10
R5143:Sbf2 UTSW 7 110422540 nonsense probably null
R5443:Sbf2 UTSW 7 110377928 intron probably benign
R5457:Sbf2 UTSW 7 110312830 missense probably benign
R5641:Sbf2 UTSW 7 110438901 missense probably damaging 1.00
R5915:Sbf2 UTSW 7 110378096 nonsense probably null
R5948:Sbf2 UTSW 7 110489285 missense probably damaging 1.00
R5977:Sbf2 UTSW 7 110377986 missense probably benign 0.00
R6052:Sbf2 UTSW 7 110441534 missense probably damaging 1.00
R6142:Sbf2 UTSW 7 110348975 missense probably damaging 1.00
R6327:Sbf2 UTSW 7 110441552 missense probably damaging 1.00
R6356:Sbf2 UTSW 7 110372623 missense probably damaging 1.00
R6450:Sbf2 UTSW 7 110462863 missense probably damaging 1.00
R6587:Sbf2 UTSW 7 110440975 missense probably damaging 1.00
R6696:Sbf2 UTSW 7 110560298 missense probably benign 0.04
R6986:Sbf2 UTSW 7 110330615 missense probably damaging 0.99
R7147:Sbf2 UTSW 7 110447061 missense probably benign 0.01
R7358:Sbf2 UTSW 7 110399348 missense possibly damaging 0.95
R7414:Sbf2 UTSW 7 110314064 missense possibly damaging 0.89
R7418:Sbf2 UTSW 7 110365821 missense probably damaging 1.00
R7423:Sbf2 UTSW 7 110438848 missense possibly damaging 0.48
R7425:Sbf2 UTSW 7 110375777 nonsense probably null
R7431:Sbf2 UTSW 7 110351750 missense probably damaging 1.00
R7497:Sbf2 UTSW 7 110614716 nonsense probably null
R7556:Sbf2 UTSW 7 110314053 missense probably benign 0.20
R7604:Sbf2 UTSW 7 110378067 missense possibly damaging 0.95
R7707:Sbf2 UTSW 7 110330713 critical splice acceptor site probably null
R7746:Sbf2 UTSW 7 110441426 missense probably benign 0.01
R7812:Sbf2 UTSW 7 110449963 missense possibly damaging 0.84
R7849:Sbf2 UTSW 7 110372510 missense probably damaging 1.00
R8048:Sbf2 UTSW 7 110315082 missense probably benign 0.21
R8305:Sbf2 UTSW 7 110371618 missense possibly damaging 0.79
R8337:Sbf2 UTSW 7 110441462 missense probably benign
RF005:Sbf2 UTSW 7 110317008 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTTACAGAGGGCACATG -3'
(R):5'- GGCATCAAATGAGTGTCGAC -3'

Sequencing Primer
(F):5'- CTTTACAGAGGGCACATGACGAAG -3'
(R):5'- GACTACTAAGCATTTCCCTGGGG -3'
Posted On2020-01-23