Mutagenetix > Incidental Mutation

Incidental Mutation 'R0659:Pik3c2b'

61772

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2b

Ensembl Gene

ENSMUSG00000026447

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta

Synonyms

C330011J12Rik, PI3K-C2beta

MMRRC Submission

038844-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.251) question?

Stock #

R0659 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

133045667-133108687 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 133071200 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 353 (D353G)

Ref Sequence

ENSEMBL: ENSMUSP00000076911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077730] [ENSMUST00000153707]

AlphaFold

E9QAN8

Predicted Effect

probably damaging
Transcript: ENSMUST00000077730
AA Change: D353G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447
AA Change: D353G

Domain	Start	End	E-Value	Type
low complexity region	155	160	N/A	INTRINSIC
low complexity region	168	183	N/A	INTRINSIC
PI3K_rbd	363	465	2.15e-19	SMART
PI3K_C2	618	726	6.17e-29	SMART
PI3Ka	804	990	1.66e-84	SMART
PI3Kc	1078	1340	3.45e-132	SMART
PX	1364	1476	9.44e-27	SMART
low complexity region	1481	1492	N/A	INTRINSIC
C2	1517	1622	1.82e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124934

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145153

Predicted Effect

probably benign
Transcript: ENSMUST00000153707

SMART Domains

Protein: ENSMUSP00000115469
Gene: ENSMUSG00000026447

Domain	Start	End	E-Value	Type
low complexity region	155	160	N/A	INTRINSIC
low complexity region	168	183	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186515

Meta Mutation Damage Score

0.3799

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.7%
20x: 95.6%

Validation Efficiency

99% (72/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts19	A	G	18: 59,007,493		probably benign	Het
Ahnak	A	G	19: 9,015,002	H4550R	possibly damaging	Het
Anxa6	A	G	11: 54,983,347	V591A	probably damaging	Het
Apol7c	A	G	15: 77,526,273	S158P	probably damaging	Het
Asxl1	T	A	2: 153,400,724	S1065T	possibly damaging	Het
Cacna2d4	A	G	6: 119,345,106		probably benign	Het
Cd109	T	C	9: 78,680,170		probably benign	Het
Cep78	C	T	19: 15,956,190	V675M	probably damaging	Het
Ces4a	T	C	8: 105,144,922		probably benign	Het
Chpf	A	G	1: 75,477,723	V137A	probably damaging	Het
Comp	T	C	8: 70,379,101	S457P	possibly damaging	Het
Cth	A	G	3: 157,920,115		probably benign	Het
Cyp2a12	T	C	7: 27,034,138	L314P	probably damaging	Het
Ets1	C	T	9: 32,738,293	R309C	probably damaging	Het
Fam208b	T	C	13: 3,574,448	D1834G	probably damaging	Het
Foxp2	T	C	6: 15,254,279		probably benign	Het
Gm9875	T	G	2: 13,558,184	F108V	unknown	Het
Golga5	G	T	12: 102,476,208	V269F	possibly damaging	Het
Greb1	T	C	12: 16,680,212	Y1738C	probably damaging	Het
Grin2a	G	T	16: 9,992,472	P21Q	probably damaging	Het
Hdac5	A	T	11: 102,196,024	V70E	probably damaging	Het
Hdac9	T	C	12: 34,437,222	Q60R	probably damaging	Het
Hsd17b3	T	C	13: 64,073,936	T92A	possibly damaging	Het
Itpk1	C	T	12: 102,606,078		probably benign	Het
Lin28a	T	C	4: 134,008,099		probably benign	Het
Mapk6	T	C	9: 75,397,962	S58G	probably damaging	Het
Mmp21	G	A	7: 133,677,667		probably benign	Het
Mroh2a	C	A	1: 88,242,420	A685D	possibly damaging	Het
Mroh2a	G	A	1: 88,250,342	D1053N	probably damaging	Het
Msh3	T	C	13: 92,345,096	N303D	possibly damaging	Het
Mto1	T	A	9: 78,457,508	I343N	probably damaging	Het
Mto1	C	T	9: 78,470,790	T638M	probably damaging	Het
Myo18b	T	C	5: 112,760,327	K2027E	possibly damaging	Het
Myo7a	T	C	7: 98,054,338		probably benign	Het
Nlrp9a	T	C	7: 26,557,278	I107T	probably damaging	Het
Olfr181	C	A	16: 58,926,409	R54L	possibly damaging	Het
Olfr970	T	G	9: 39,819,816	M59R	possibly damaging	Het
Osbpl5	A	G	7: 143,705,030	S268P	probably damaging	Het
Pih1d1	T	A	7: 45,159,975	S289T	probably benign	Het
Ppef2	A	G	5: 92,230,509	L609P	probably damaging	Het
Prune2	A	T	19: 17,122,835	D1901V	probably damaging	Het
Rdh9	T	C	10: 127,776,575	Y31H	possibly damaging	Het
Slc5a9	T	A	4: 111,883,871	Y526F	possibly damaging	Het
Slitrk5	A	G	14: 111,680,689	K582E	probably benign	Het
Sult1c2	A	T	17: 53,831,778	M257K	probably damaging	Het
Tmem132d	A	G	5: 127,984,287	I417T	possibly damaging	Het
Tmem229b	T	C	12: 78,965,134	T8A	probably benign	Het
Tmem237	T	C	1: 59,114,094	I89M	possibly damaging	Het
Tnfrsf17	A	T	16: 11,319,819	D140V	probably damaging	Het
Tnrc6b	T	A	15: 80,923,446		probably benign	Het
Trio	A	G	15: 27,831,399	L194P	probably damaging	Het
Vmn2r74	T	C	7: 85,955,914		probably benign	Het
Vps13c	T	A	9: 67,920,935	M1457K	probably benign	Het
Zfhx2	A	G	14: 55,073,801	C479R	possibly damaging	Het
Zfp420	T	A	7: 29,875,539	C395S	probably damaging	Het
Zfp740	A	G	15: 102,212,659	T136A	possibly damaging	Het
Zfp82	C	T	7: 30,056,329	E443K	probably damaging	Het
Zranb2	A	G	3: 157,541,763	S193G	probably benign	Het

Other mutations in Pik3c2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Pik3c2b	APN	1	133091618	missense	probably damaging	0.98
IGL01288:Pik3c2b	APN	1	133094805	missense	probably damaging	0.96
IGL01313:Pik3c2b	APN	1	133071631	nonsense	probably null
IGL01367:Pik3c2b	APN	1	133105988	missense	probably benign	0.02
IGL02379:Pik3c2b	APN	1	133094791	missense	probably damaging	1.00
IGL02638:Pik3c2b	APN	1	133077318	splice site	probably benign
IGL02728:Pik3c2b	APN	1	133092327	missense	probably benign	0.09
IGL02992:Pik3c2b	APN	1	133066980	nonsense	probably null
IGL03121:Pik3c2b	APN	1	133079745	missense	probably benign	0.00
R0453:Pik3c2b	UTSW	1	133077396	missense	probably damaging	1.00
R0518:Pik3c2b	UTSW	1	133105992	missense	probably damaging	1.00
R0616:Pik3c2b	UTSW	1	133100831	missense	probably damaging	1.00
R1542:Pik3c2b	UTSW	1	133090034	missense	probably damaging	1.00
R1716:Pik3c2b	UTSW	1	133094826	missense	probably damaging	1.00
R1728:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1729:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1730:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1739:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1762:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1783:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1784:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1785:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1816:Pik3c2b	UTSW	1	133101370	missense	probably benign	0.00
R1897:Pik3c2b	UTSW	1	133066916	missense	possibly damaging	0.57
R2006:Pik3c2b	UTSW	1	133066544	missense	probably damaging	1.00
R2067:Pik3c2b	UTSW	1	133099611	missense	probably damaging	1.00
R2271:Pik3c2b	UTSW	1	133103428	missense	probably benign
R2294:Pik3c2b	UTSW	1	133066775	missense	probably damaging	1.00
R2320:Pik3c2b	UTSW	1	133103413	missense	probably damaging	1.00
R4735:Pik3c2b	UTSW	1	133067049	missense	probably benign	0.25
R4926:Pik3c2b	UTSW	1	133099626	nonsense	probably null
R4948:Pik3c2b	UTSW	1	133099715	critical splice donor site	probably null
R4997:Pik3c2b	UTSW	1	133105081	missense	probably damaging	1.00
R5304:Pik3c2b	UTSW	1	133070408	missense	possibly damaging	0.50
R5461:Pik3c2b	UTSW	1	133099702	missense	possibly damaging	0.66
R5722:Pik3c2b	UTSW	1	133103836	missense	probably damaging	1.00
R5971:Pik3c2b	UTSW	1	133074627	splice site	probably null
R5980:Pik3c2b	UTSW	1	133088308	missense	probably benign	0.43
R6036:Pik3c2b	UTSW	1	133090713	missense	possibly damaging	0.95
R6138:Pik3c2b	UTSW	1	133074627	splice site	probably null
R6223:Pik3c2b	UTSW	1	133070357	missense	probably damaging	1.00
R6273:Pik3c2b	UTSW	1	133066711	missense	probably benign	0.02
R6742:Pik3c2b	UTSW	1	133075821	missense	probably benign
R6954:Pik3c2b	UTSW	1	133066303	missense	possibly damaging	0.50
R6998:Pik3c2b	UTSW	1	133102372	missense	probably benign	0.23
R7103:Pik3c2b	UTSW	1	133105974	missense	probably damaging	1.00
R7133:Pik3c2b	UTSW	1	133090234	missense	possibly damaging	0.73
R7161:Pik3c2b	UTSW	1	133106112	missense	probably damaging	0.98
R7183:Pik3c2b	UTSW	1	133066465	missense	probably benign	0.00
R7193:Pik3c2b	UTSW	1	133079774	missense	probably benign	0.00
R7252:Pik3c2b	UTSW	1	133094734	missense	probably benign	0.19
R7263:Pik3c2b	UTSW	1	133090202	missense	probably damaging	0.98
R7404:Pik3c2b	UTSW	1	133090706	missense	probably damaging	1.00
R7709:Pik3c2b	UTSW	1	133079841	critical splice donor site	probably null
R7712:Pik3c2b	UTSW	1	133085611	missense	probably damaging	1.00
R7823:Pik3c2b	UTSW	1	133102305	missense	probably damaging	1.00
R7831:Pik3c2b	UTSW	1	133071242	missense	possibly damaging	0.94
R7913:Pik3c2b	UTSW	1	133090061	critical splice donor site	probably null
R7916:Pik3c2b	UTSW	1	133100904	missense	probably benign	0.30
R7960:Pik3c2b	UTSW	1	133103849	missense	probably damaging	1.00
R7981:Pik3c2b	UTSW	1	133075809	critical splice acceptor site	probably null
R8346:Pik3c2b	UTSW	1	133090246	missense	probably damaging	0.97
R8938:Pik3c2b	UTSW	1	133088330	missense	probably benign	0.19
R8997:Pik3c2b	UTSW	1	133090779	missense	possibly damaging	0.83
R9416:Pik3c2b	UTSW	1	133077449	missense	probably damaging	1.00
R9598:Pik3c2b	UTSW	1	133084987	critical splice donor site	probably null
R9621:Pik3c2b	UTSW	1	133071607	missense	probably damaging	1.00
R9742:Pik3c2b	UTSW	1	133094749	missense	probably damaging	1.00
R9776:Pik3c2b	UTSW	1	133090850	missense	possibly damaging	0.64
R9786:Pik3c2b	UTSW	1	133091600	missense	possibly damaging	0.94
U15987:Pik3c2b	UTSW	1	133074627	splice site	probably null
X0060:Pik3c2b	UTSW	1	133084936	missense	probably benign	0.18
Z1176:Pik3c2b	UTSW	1	133066553	missense	probably damaging	1.00
Z1176:Pik3c2b	UTSW	1	133099686	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GTTTGTGACTGTAGCAGAGATGACCAG -3'
(R):5'- CCCTTCAGAAAAGTCTTCATTCAGGCG -3'

Sequencing Primer
(F):5'- GAGATGACCAGAAAGACTACAGCC -3'
(R):5'- TCTTCATTCAGGCGACAGAG -3'

Posted On

2013-07-30