Incidental Mutation 'R8026:Cobl'
ID617722
Institutional Source Beutler Lab
Gene Symbol Cobl
Ensembl Gene ENSMUSG00000020173
Gene Namecordon-bleu WH2 repeat
SynonymsC530045F18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8026 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location12236608-12464960 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12253459 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 1081 (K1081R)
Ref Sequence ENSEMBL: ENSMUSP00000045693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046755] [ENSMUST00000109650] [ENSMUST00000109651] [ENSMUST00000172919] [ENSMUST00000172956] [ENSMUST00000174874]
PDB Structure Actin complex with Gelsolin Segment 1 fused to Cobl segment [X-RAY DIFFRACTION]
Crystal Structure of an Actin Dimer in Complex with the Actin Nucleator Cordon-Bleu [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000046755
AA Change: K1081R

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000045693
Gene: ENSMUSG00000020173
AA Change: K1081R

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 144 235 2.2e-46 PFAM
low complexity region 328 333 N/A INTRINSIC
low complexity region 360 376 N/A INTRINSIC
low complexity region 408 433 N/A INTRINSIC
low complexity region 468 482 N/A INTRINSIC
low complexity region 526 541 N/A INTRINSIC
coiled coil region 564 589 N/A INTRINSIC
WH2 1185 1205 1.32e0 SMART
WH2 1225 1245 6.36e-3 SMART
low complexity region 1276 1296 N/A INTRINSIC
WH2 1313 1333 3.91e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109650
AA Change: K999R

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000105277
Gene: ENSMUSG00000020173
AA Change: K999R

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 1.6e-40 PFAM
low complexity region 303 308 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
low complexity region 444 459 N/A INTRINSIC
coiled coil region 482 507 N/A INTRINSIC
WH2 1103 1123 1.32e0 SMART
WH2 1143 1163 6.36e-3 SMART
low complexity region 1194 1214 N/A INTRINSIC
WH2 1231 1251 3.91e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109651
AA Change: K1056R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000105278
Gene: ENSMUSG00000020173
AA Change: K1056R

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 1.2e-40 PFAM
low complexity region 303 308 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
low complexity region 383 408 N/A INTRINSIC
low complexity region 443 457 N/A INTRINSIC
low complexity region 501 516 N/A INTRINSIC
coiled coil region 539 564 N/A INTRINSIC
WH2 1160 1180 1.32e0 SMART
WH2 1200 1220 6.36e-3 SMART
low complexity region 1251 1271 N/A INTRINSIC
WH2 1288 1308 3.91e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172919
SMART Domains Protein: ENSMUSP00000133669
Gene: ENSMUSG00000020173

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 2.6e-41 PFAM
low complexity region 328 333 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172956
SMART Domains Protein: ENSMUSP00000134372
Gene: ENSMUSG00000020173

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 2.4e-41 PFAM
low complexity region 303 308 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174874
AA Change: K1074R

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000133470
Gene: ENSMUSG00000020173
AA Change: K1074R

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
Pfam:Cobl 175 253 1.2e-40 PFAM
low complexity region 321 326 N/A INTRINSIC
low complexity region 353 369 N/A INTRINSIC
low complexity region 401 426 N/A INTRINSIC
low complexity region 461 475 N/A INTRINSIC
low complexity region 519 534 N/A INTRINSIC
coiled coil region 557 582 N/A INTRINSIC
WH2 1178 1198 1.32e0 SMART
WH2 1218 1238 6.36e-3 SMART
low complexity region 1269 1289 N/A INTRINSIC
WH2 1306 1326 3.91e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains WH2 domains (WASP, Wiskott-Aldrich syndrome protein, homology domain-2) that interact with actin. The encoded actin regulator protein is required for growth and assembly of brush border microvilli that play a role in maintaining intestinal homeostasis. A similar protein in mouse functions in midbrain neural tube closure. A pseudogene of this gene is located on chromosome X. [provided by RefSeq, Oct 2016]
PHENOTYPE: Animals homozygous for this mutation do not display a phenotype. However, the allele exacerbates the neural tube defects seen in the loop tail mouse. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,406,725 V513A probably damaging Het
Acsf2 C T 11: 94,562,888 V416M probably damaging Het
Adrm1 G A 2: 180,175,209 A225T unknown Het
Aldh9a1 T C 1: 167,352,667 probably null Het
Apbb2 T C 5: 66,451,644 D220G probably benign Het
B230118H07Rik A T 2: 101,570,644 probably benign Het
Bace2 T C 16: 97,436,852 V501A probably benign Het
Camsap1 T C 2: 25,938,202 N1170S probably benign Het
Casr A G 16: 36,495,617 V697A probably damaging Het
Clcn1 T C 6: 42,307,661 probably null Het
Ctr9 T A 7: 111,033,892 L116I probably damaging Het
Dennd4a T C 9: 64,873,030 F616S probably damaging Het
Dynlt1a C T 17: 6,311,814 G30S possibly damaging Het
Eif1 T C 11: 100,320,448 S23P possibly damaging Het
Eml6 A C 11: 29,749,973 L1721R possibly damaging Het
Fscb A G 12: 64,474,275 I139T probably benign Het
Fstl4 A G 11: 53,068,669 E179G probably damaging Het
Fuom T C 7: 140,100,154 T95A Het
Gigyf1 C T 5: 137,525,478 H1001Y probably damaging Het
Gm21886 T A 18: 80,089,746 S66C probably damaging Het
Helz2 G A 2: 181,240,205 T265I probably benign Het
Hs6st3 G T 14: 119,869,556 V459F probably damaging Het
Ido2 A G 8: 24,535,140 probably null Het
Idua A G 5: 108,670,249 I96V probably benign Het
Inpp5j A G 11: 3,495,171 S494P Het
Krt19 A G 11: 100,141,383 V285A probably damaging Het
Krt71 T G 15: 101,738,382 D297A possibly damaging Het
L3hypdh G A 12: 72,084,949 R70C probably damaging Het
Masp1 T C 16: 23,484,406 Y324C probably damaging Het
Mfap2 A G 4: 141,013,803 D25G possibly damaging Het
Mmp17 G A 5: 129,595,084 probably null Het
Mroh7 G A 4: 106,721,437 P15S probably benign Het
Muc5b T A 7: 141,863,636 C3440S probably benign Het
Naip5 C A 13: 100,245,898 S101I probably damaging Het
Neb A T 2: 52,223,048 Y1066N Het
Nop56 T A 2: 130,277,268 C38S probably benign Het
Nup214 T A 2: 32,033,350 L1297Q possibly damaging Het
Oasl2 C A 5: 114,902,268 probably benign Het
Olfr1242 A G 2: 89,493,788 F175L probably damaging Het
Olfr192 T C 16: 59,098,368 H208R unknown Het
Olfr48 T C 2: 89,844,929 N15D probably benign Het
Olfr66 A G 7: 103,881,697 V182A possibly damaging Het
Olfr68 T A 7: 103,778,340 I2F probably benign Het
Olfr967 T C 9: 39,750,796 S137P possibly damaging Het
Pacrg C T 17: 10,576,567 V155I probably benign Het
Patz1 A T 11: 3,307,658 M96L probably benign Het
Pcca A G 14: 122,638,382 D141G probably benign Het
Ptprr A G 10: 116,048,170 Y44C probably damaging Het
Rad51ap1 A G 6: 126,934,712 probably null Het
Raet1e A C 10: 22,181,299 D174A probably damaging Het
Rhobtb2 T G 14: 69,796,765 D337A probably benign Het
Sbf2 T C 7: 110,335,387 K1377E probably damaging Het
Sh3pxd2b A G 11: 32,411,567 K260E probably damaging Het
Slc4a8 A T 15: 100,787,289 I234F possibly damaging Het
Srgap3 C T 6: 112,739,364 R625H probably benign Het
Tbxas1 C T 6: 39,027,896 T359I probably benign Het
Trim9 T A 12: 70,290,387 S309C probably benign Het
Ttn G A 2: 76,829,139 P12191S unknown Het
Unc80 A G 1: 66,483,304 R222G possibly damaging Het
Vmn1r202 A T 13: 22,502,144 H34Q possibly damaging Het
Vmn2r61 T A 7: 42,266,717 N251K probably benign Het
Vmn2r67 A T 7: 85,136,716 Y694N probably damaging Het
Vwde A G 6: 13,205,783 F255S probably benign Het
Zfp532 T G 18: 65,625,156 I720R possibly damaging Het
Zfp819 A G 7: 43,617,895 T601A probably benign Het
Zfp853 G T 5: 143,288,525 Q462K unknown Het
Other mutations in Cobl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Cobl APN 11 12375813 missense possibly damaging 0.89
IGL00698:Cobl APN 11 12253722 missense probably benign 0.41
IGL00772:Cobl APN 11 12266985 missense probably benign 0.02
IGL00922:Cobl APN 11 12254866 missense probably damaging 1.00
IGL00985:Cobl APN 11 12254843 missense probably damaging 1.00
IGL01641:Cobl APN 11 12309641 nonsense probably null
IGL01722:Cobl APN 11 12253987 missense probably benign 0.00
IGL01734:Cobl APN 11 12254980 splice site probably benign
IGL01924:Cobl APN 11 12254596 missense probably benign 0.30
IGL02105:Cobl APN 11 12249651 missense probably damaging 1.00
IGL02326:Cobl APN 11 12386712 missense possibly damaging 0.69
IGL02342:Cobl APN 11 12253672 missense possibly damaging 0.64
IGL02426:Cobl APN 11 12254351 nonsense probably null
IGL02754:Cobl APN 11 12254371 missense probably damaging 1.00
IGL02754:Cobl APN 11 12254370 missense probably damaging 1.00
IGL02811:Cobl APN 11 12253285 missense possibly damaging 0.56
IGL02859:Cobl APN 11 12369602 missense probably damaging 1.00
IGL02999:Cobl APN 11 12343869 missense possibly damaging 0.71
IGL03030:Cobl APN 11 12254241 missense possibly damaging 0.80
IGL03191:Cobl APN 11 12253364 missense probably benign 0.00
PIT4418001:Cobl UTSW 11 12256240 missense possibly damaging 0.79
PIT4480001:Cobl UTSW 11 12253592 missense probably benign
PIT4495001:Cobl UTSW 11 12254596 missense probably benign 0.00
R0031:Cobl UTSW 11 12254945 missense probably benign 0.36
R0241:Cobl UTSW 11 12254524 missense probably benign 0.25
R0241:Cobl UTSW 11 12254524 missense probably benign 0.25
R0322:Cobl UTSW 11 12267072 missense probably damaging 1.00
R0597:Cobl UTSW 11 12254699 missense probably benign 0.24
R0733:Cobl UTSW 11 12365167 missense probably benign 0.31
R0734:Cobl UTSW 11 12375971 missense probably damaging 1.00
R0784:Cobl UTSW 11 12266843 splice site probably benign
R0884:Cobl UTSW 11 12375908 missense possibly damaging 0.89
R1065:Cobl UTSW 11 12254327 missense possibly damaging 0.67
R1331:Cobl UTSW 11 12375853 missense probably damaging 0.96
R1892:Cobl UTSW 11 12253258 missense probably damaging 0.99
R2847:Cobl UTSW 11 12378342 missense probably damaging 1.00
R2848:Cobl UTSW 11 12378342 missense probably damaging 1.00
R3407:Cobl UTSW 11 12375830 missense probably damaging 1.00
R4627:Cobl UTSW 11 12251093 missense probably damaging 1.00
R4662:Cobl UTSW 11 12253672 missense probably benign 0.08
R4677:Cobl UTSW 11 12386665 missense possibly damaging 0.93
R4844:Cobl UTSW 11 12254740 missense probably benign 0.10
R4942:Cobl UTSW 11 12254185 missense probably damaging 0.99
R5158:Cobl UTSW 11 12256198 missense possibly damaging 0.84
R5195:Cobl UTSW 11 12253565 missense probably benign 0.02
R5255:Cobl UTSW 11 12375825 missense probably damaging 1.00
R5588:Cobl UTSW 11 12343886 nonsense probably null
R5637:Cobl UTSW 11 12296531 intron probably benign
R5643:Cobl UTSW 11 12306948 splice site probably benign
R5749:Cobl UTSW 11 12266965 missense possibly damaging 0.86
R5953:Cobl UTSW 11 12256220 missense probably benign 0.00
R6000:Cobl UTSW 11 12369684 missense probably benign 0.08
R6373:Cobl UTSW 11 12253118 missense probably damaging 1.00
R7034:Cobl UTSW 11 12254177 missense probably damaging 1.00
R7071:Cobl UTSW 11 12254795 missense probably benign 0.00
R7077:Cobl UTSW 11 12253441 missense probably benign 0.04
R7078:Cobl UTSW 11 12378271 missense probably damaging 1.00
R7099:Cobl UTSW 11 12296540 missense
R7153:Cobl UTSW 11 12254128 missense probably damaging 1.00
R7448:Cobl UTSW 11 12256225 missense possibly damaging 0.46
R7519:Cobl UTSW 11 12253124 missense probably damaging 1.00
R7767:Cobl UTSW 11 12412117 start gained probably benign
R7772:Cobl UTSW 11 12254488 missense probably benign 0.29
R7841:Cobl UTSW 11 12253324 missense probably damaging 1.00
R7845:Cobl UTSW 11 12365139 missense probably benign 0.35
R8118:Cobl UTSW 11 12254834 missense probably benign 0.03
R8192:Cobl UTSW 11 12249745 missense probably benign 0.07
R8320:Cobl UTSW 11 12267001 missense probably damaging 1.00
R8338:Cobl UTSW 11 12253696 missense probably benign 0.41
Z1176:Cobl UTSW 11 12253433 missense probably benign 0.02
Z1176:Cobl UTSW 11 12369645 missense probably damaging 1.00
Z1176:Cobl UTSW 11 12375827 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGAACTGGGCTTTTCCTC -3'
(R):5'- AACCCTGGTGTGCAATTGC -3'

Sequencing Primer
(F):5'- ACTGGGCTTTTCCTCTGTCTGTAAG -3'
(R):5'- TGTGCAATTGCCAGCAGG -3'
Posted On2020-01-23