Incidental Mutation 'R0659:Asxl1'
ID61774
Institutional Source Beutler Lab
Gene Symbol Asxl1
Ensembl Gene ENSMUSG00000042548
Gene Nameadditional sex combs like 1
Synonyms
MMRRC Submission 038844-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0659 (G1)
Quality Score202
Status Validated
Chromosome2
Chromosomal Location153345829-153404007 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 153400724 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1065 (S1065T)
Ref Sequence ENSEMBL: ENSMUSP00000154224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109790] [ENSMUST00000227428]
Predicted Effect probably benign
Transcript: ENSMUST00000109790
AA Change: S1066T

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105413
Gene: ENSMUSG00000042548
AA Change: S1066T

DomainStartEndE-ValueType
Pfam:HARE-HTH 11 83 1.6e-20 PFAM
low complexity region 199 209 N/A INTRINSIC
Pfam:ASXH 236 361 5.9e-40 PFAM
low complexity region 411 422 N/A INTRINSIC
low complexity region 639 667 N/A INTRINSIC
low complexity region 705 716 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 986 1000 N/A INTRINSIC
Pfam:PHD_3 1446 1512 6.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138571
Predicted Effect possibly damaging
Transcript: ENSMUST00000227428
AA Change: S1065T

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.6%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to the Drosophila additional sex combs gene, which encodes a chromatin-binding protein required for normal determination of segment identity in the developing embryo. The protein is a member of the Polycomb group of proteins, which are necessary for the maintenance of stable repression of homeotic and other loci. The protein is thought to disrupt chromatin in localized areas, enhancing transcription of certain genes while repressing the transcription of other genes. The protein encoded by this gene functions as a ligand-dependent co-activator for retinoic acid receptor in cooperation with nuclear receptor coactivator 1. Mutations in this gene are associated with myelodysplastic syndromes and chronic myelomonocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Disruption of this gene causes alterations in lymphocyte development in adult mice. Mice homozygous for a different knock-out allele exhibit complete lethality. Mice heterozygous for this allele exhibit eye opacity and abnormal vertebrae morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A G 18: 59,007,493 probably benign Het
Ahnak A G 19: 9,015,002 H4550R possibly damaging Het
Anxa6 A G 11: 54,983,347 V591A probably damaging Het
Apol7c A G 15: 77,526,273 S158P probably damaging Het
Cacna2d4 A G 6: 119,345,106 probably benign Het
Cd109 T C 9: 78,680,170 probably benign Het
Cep78 C T 19: 15,956,190 V675M probably damaging Het
Ces4a T C 8: 105,144,922 probably benign Het
Chpf A G 1: 75,477,723 V137A probably damaging Het
Comp T C 8: 70,379,101 S457P possibly damaging Het
Cth A G 3: 157,920,115 probably benign Het
Cyp2a12 T C 7: 27,034,138 L314P probably damaging Het
Ets1 C T 9: 32,738,293 R309C probably damaging Het
Fam208b T C 13: 3,574,448 D1834G probably damaging Het
Foxp2 T C 6: 15,254,279 probably benign Het
Gm9875 T G 2: 13,558,184 F108V unknown Het
Golga5 G T 12: 102,476,208 V269F possibly damaging Het
Greb1 T C 12: 16,680,212 Y1738C probably damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Hdac5 A T 11: 102,196,024 V70E probably damaging Het
Hdac9 T C 12: 34,437,222 Q60R probably damaging Het
Hsd17b3 T C 13: 64,073,936 T92A possibly damaging Het
Itpk1 C T 12: 102,606,078 probably benign Het
Lin28a T C 4: 134,008,099 probably benign Het
Mapk6 T C 9: 75,397,962 S58G probably damaging Het
Mmp21 G A 7: 133,677,667 probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mroh2a G A 1: 88,250,342 D1053N probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Mto1 T A 9: 78,457,508 I343N probably damaging Het
Mto1 C T 9: 78,470,790 T638M probably damaging Het
Myo18b T C 5: 112,760,327 K2027E possibly damaging Het
Myo7a T C 7: 98,054,338 probably benign Het
Nlrp9a T C 7: 26,557,278 I107T probably damaging Het
Olfr181 C A 16: 58,926,409 R54L possibly damaging Het
Olfr970 T G 9: 39,819,816 M59R possibly damaging Het
Osbpl5 A G 7: 143,705,030 S268P probably damaging Het
Pih1d1 T A 7: 45,159,975 S289T probably benign Het
Pik3c2b A G 1: 133,071,200 D353G probably damaging Het
Ppef2 A G 5: 92,230,509 L609P probably damaging Het
Prune2 A T 19: 17,122,835 D1901V probably damaging Het
Rdh9 T C 10: 127,776,575 Y31H possibly damaging Het
Slc5a9 T A 4: 111,883,871 Y526F possibly damaging Het
Slitrk5 A G 14: 111,680,689 K582E probably benign Het
Sult1c2 A T 17: 53,831,778 M257K probably damaging Het
Tmem132d A G 5: 127,984,287 I417T possibly damaging Het
Tmem229b T C 12: 78,965,134 T8A probably benign Het
Tmem237 T C 1: 59,114,094 I89M possibly damaging Het
Tnfrsf17 A T 16: 11,319,819 D140V probably damaging Het
Tnrc6b T A 15: 80,923,446 probably benign Het
Trio A G 15: 27,831,399 L194P probably damaging Het
Vmn2r74 T C 7: 85,955,914 probably benign Het
Vps13c T A 9: 67,920,935 M1457K probably benign Het
Zfhx2 A G 14: 55,073,801 C479R possibly damaging Het
Zfp420 T A 7: 29,875,539 C395S probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Zfp82 C T 7: 30,056,329 E443K probably damaging Het
Zranb2 A G 3: 157,541,763 S193G probably benign Het
Other mutations in Asxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Asxl1 APN 2 153392940 splice site probably benign
IGL01432:Asxl1 APN 2 153400205 missense probably benign 0.38
IGL01543:Asxl1 APN 2 153401484 missense probably benign 0.11
IGL02355:Asxl1 APN 2 153401786 missense probably benign 0.34
IGL02362:Asxl1 APN 2 153401786 missense probably benign 0.34
IGL02645:Asxl1 APN 2 153392857 missense possibly damaging 0.94
IGL02696:Asxl1 APN 2 153400195 nonsense probably null
IGL03365:Asxl1 APN 2 153401754 missense probably damaging 1.00
IGL03372:Asxl1 APN 2 153400413 missense probably damaging 0.99
IGL03377:Asxl1 APN 2 153396780 missense probably damaging 1.00
astrophel UTSW 2 153400106 missense possibly damaging 0.75
hairbrush UTSW 2 153400724 missense possibly damaging 0.55
R0044:Asxl1 UTSW 2 153400209 missense probably benign 0.06
R0044:Asxl1 UTSW 2 153400209 missense probably benign 0.06
R0600:Asxl1 UTSW 2 153399904 missense probably benign 0.00
R0661:Asxl1 UTSW 2 153400724 missense possibly damaging 0.55
R0684:Asxl1 UTSW 2 153397522 missense probably damaging 1.00
R1606:Asxl1 UTSW 2 153400455 missense probably damaging 0.99
R1747:Asxl1 UTSW 2 153393454 missense possibly damaging 0.86
R1796:Asxl1 UTSW 2 153401606 missense probably benign 0.31
R1914:Asxl1 UTSW 2 153401906 missense probably damaging 1.00
R2099:Asxl1 UTSW 2 153352267 missense possibly damaging 0.95
R2373:Asxl1 UTSW 2 153401900 missense probably benign 0.13
R2910:Asxl1 UTSW 2 153401039 missense probably benign 0.00
R3620:Asxl1 UTSW 2 153357155 missense probably damaging 1.00
R3701:Asxl1 UTSW 2 153399344 missense probably benign 0.04
R4200:Asxl1 UTSW 2 153400106 missense possibly damaging 0.75
R4773:Asxl1 UTSW 2 153401985 missense probably damaging 1.00
R4902:Asxl1 UTSW 2 153399831 missense probably benign 0.02
R5100:Asxl1 UTSW 2 153397931 missense probably damaging 1.00
R5102:Asxl1 UTSW 2 153400955 missense probably benign 0.00
R5166:Asxl1 UTSW 2 153401121 missense probably damaging 1.00
R5421:Asxl1 UTSW 2 153399584 missense probably benign 0.04
R5701:Asxl1 UTSW 2 153399489 missense probably damaging 1.00
R5861:Asxl1 UTSW 2 153399390 missense probably damaging 0.99
R5973:Asxl1 UTSW 2 153402011 missense probably damaging 0.97
R6384:Asxl1 UTSW 2 153391824 critical splice donor site probably null
R7023:Asxl1 UTSW 2 153400549 missense probably benign 0.00
R7028:Asxl1 UTSW 2 153400107 missense probably benign 0.00
R7176:Asxl1 UTSW 2 153401988 missense probably damaging 1.00
R7297:Asxl1 UTSW 2 153397435 missense probably benign 0.01
R7378:Asxl1 UTSW 2 153401993 missense probably damaging 1.00
R7464:Asxl1 UTSW 2 153397785 missense probably benign 0.01
R7678:Asxl1 UTSW 2 153400652 missense probably damaging 1.00
R7686:Asxl1 UTSW 2 153391614 missense probably damaging 1.00
R7789:Asxl1 UTSW 2 153400023 missense probably benign 0.00
R7838:Asxl1 UTSW 2 153396813 missense probably damaging 1.00
R7898:Asxl1 UTSW 2 153399934 missense possibly damaging 0.65
R8281:Asxl1 UTSW 2 153399401 missense probably damaging 1.00
R8354:Asxl1 UTSW 2 153393425 missense probably benign 0.40
R8383:Asxl1 UTSW 2 153393719 missense probably damaging 1.00
X0024:Asxl1 UTSW 2 153401985 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCACTGTCCAAGGTGAACAATG -3'
(R):5'- TGACAAGACCAGCACTTGCTCC -3'

Sequencing Primer
(F):5'- TGTCCAAGGTGAACAATGACCTAAG -3'
(R):5'- TGGGCCAGAATAGACTCTTTC -3'
Posted On2013-07-30