Incidental Mutation 'R8026:Bace2'
ID 617742
Institutional Source Beutler Lab
Gene Symbol Bace2
Ensembl Gene ENSMUSG00000040605
Gene Name beta-site APP-cleaving enzyme 2
Synonyms ARP1, 1110059C24Rik, BAE2, ALP56, ASP21, CDA13, CEAP1
MMRRC Submission 067465-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R8026 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 97157942-97244136 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 97238052 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 501 (V501A)
Ref Sequence ENSEMBL: ENSMUSP00000043918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047275]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000047275
AA Change: V501A

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000043918
Gene: ENSMUSG00000040605
AA Change: V501A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Asp 87 427 2.3e-47 PFAM
Pfam:TAXi_C 269 426 4.4e-16 PFAM
transmembrane domain 466 488 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231892
Meta Mutation Damage Score 0.0920 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase A1 family of aspartic proteases. The encoded preproprotein undergoes proteolytic processing to generate an active endopeptidase enzyme. This transmembrane protease catalyzes the proteolysis of amyloid precursor protein to produce amyloid beta peptide. Mice lacking the encoded product exhibit increased pancreatic beta cell mass and improved glucose tolerance due to increased insulin secretion. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in impaired APP processing by neurons and glia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,611,723 (GRCm39) V513A probably damaging Het
Acsf2 C T 11: 94,453,714 (GRCm39) V416M probably damaging Het
Adrm1 G A 2: 179,817,002 (GRCm39) A225T unknown Het
Aldh9a1 T C 1: 167,180,236 (GRCm39) probably null Het
Apbb2 T C 5: 66,608,987 (GRCm39) D220G probably benign Het
Camsap1 T C 2: 25,828,214 (GRCm39) N1170S probably benign Het
Casr A G 16: 36,315,979 (GRCm39) V697A probably damaging Het
Clcn1 T C 6: 42,284,595 (GRCm39) probably null Het
Cobl T C 11: 12,203,459 (GRCm39) K1081R probably benign Het
Ctr9 T A 7: 110,633,099 (GRCm39) L116I probably damaging Het
Dennd4a T C 9: 64,780,312 (GRCm39) F616S probably damaging Het
Dynlt1a C T 17: 6,362,089 (GRCm39) G30S possibly damaging Het
Eif1 T C 11: 100,211,274 (GRCm39) S23P possibly damaging Het
Eml6 A C 11: 29,699,973 (GRCm39) L1721R possibly damaging Het
Fscb A G 12: 64,521,049 (GRCm39) I139T probably benign Het
Fstl4 A G 11: 52,959,496 (GRCm39) E179G probably damaging Het
Fuom T C 7: 139,680,067 (GRCm39) T95A Het
Gigyf1 C T 5: 137,523,740 (GRCm39) H1001Y probably damaging Het
Gm21886 T A 18: 80,132,961 (GRCm39) S66C probably damaging Het
Helz2 G A 2: 180,881,998 (GRCm39) T265I probably benign Het
Hs6st3 G T 14: 120,106,968 (GRCm39) V459F probably damaging Het
Ido2 A G 8: 25,025,156 (GRCm39) probably null Het
Idua A G 5: 108,818,115 (GRCm39) I96V probably benign Het
Iftap A T 2: 101,400,989 (GRCm39) probably benign Het
Inpp5j A G 11: 3,445,171 (GRCm39) S494P Het
Krt19 A G 11: 100,032,209 (GRCm39) V285A probably damaging Het
Krt71 T G 15: 101,646,817 (GRCm39) D297A possibly damaging Het
L3hypdh G A 12: 72,131,723 (GRCm39) R70C probably damaging Het
Masp1 T C 16: 23,303,156 (GRCm39) Y324C probably damaging Het
Mfap2 A G 4: 140,741,114 (GRCm39) D25G possibly damaging Het
Mmp17 G A 5: 129,672,148 (GRCm39) probably null Het
Mroh7 G A 4: 106,578,634 (GRCm39) P15S probably benign Het
Muc5b T A 7: 141,417,373 (GRCm39) C3440S probably benign Het
Naip5 C A 13: 100,382,406 (GRCm39) S101I probably damaging Het
Neb A T 2: 52,113,060 (GRCm39) Y1066N Het
Nop56 T A 2: 130,119,188 (GRCm39) C38S probably benign Het
Nup214 T A 2: 31,923,362 (GRCm39) L1297Q possibly damaging Het
Oasl2 C A 5: 115,040,329 (GRCm39) probably benign Het
Or4a70 A G 2: 89,324,132 (GRCm39) F175L probably damaging Het
Or4c58 T C 2: 89,675,273 (GRCm39) N15D probably benign Het
Or51b4 A G 7: 103,530,904 (GRCm39) V182A possibly damaging Het
Or52a5 T A 7: 103,427,547 (GRCm39) I2F probably benign Het
Or5h24 T C 16: 58,918,731 (GRCm39) H208R unknown Het
Or8g4 T C 9: 39,662,092 (GRCm39) S137P possibly damaging Het
Pacrg C T 17: 10,795,496 (GRCm39) V155I probably benign Het
Patz1 A T 11: 3,257,658 (GRCm39) M96L probably benign Het
Pcca A G 14: 122,875,794 (GRCm39) D141G probably benign Het
Ptprr A G 10: 115,884,075 (GRCm39) Y44C probably damaging Het
Rad51ap1 A G 6: 126,911,675 (GRCm39) probably null Het
Raet1e A C 10: 22,057,198 (GRCm39) D174A probably damaging Het
Rhobtb2 T G 14: 70,034,214 (GRCm39) D337A probably benign Het
Sbf2 T C 7: 109,934,594 (GRCm39) K1377E probably damaging Het
Sh3pxd2b A G 11: 32,361,567 (GRCm39) K260E probably damaging Het
Slc4a8 A T 15: 100,685,170 (GRCm39) I234F possibly damaging Het
Srgap3 C T 6: 112,716,325 (GRCm39) R625H probably benign Het
Tbxas1 C T 6: 39,004,830 (GRCm39) T359I probably benign Het
Trim9 T A 12: 70,337,161 (GRCm39) S309C probably benign Het
Ttn G A 2: 76,659,483 (GRCm39) P12191S unknown Het
Unc80 A G 1: 66,522,463 (GRCm39) R222G possibly damaging Het
Vmn1r202 A T 13: 22,686,314 (GRCm39) H34Q possibly damaging Het
Vmn2r61 T A 7: 41,916,141 (GRCm39) N251K probably benign Het
Vmn2r67 A T 7: 84,785,924 (GRCm39) Y694N probably damaging Het
Vwde A G 6: 13,205,782 (GRCm39) F255S probably benign Het
Zfp532 T G 18: 65,758,227 (GRCm39) I720R possibly damaging Het
Zfp819 A G 7: 43,267,319 (GRCm39) T601A probably benign Het
Zfp853 G T 5: 143,274,280 (GRCm39) Q462K unknown Het
Other mutations in Bace2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Bace2 APN 16 97,209,630 (GRCm39) missense probably damaging 0.97
IGL02660:Bace2 APN 16 97,216,340 (GRCm39) missense probably damaging 1.00
IGL02669:Bace2 APN 16 97,238,093 (GRCm39) makesense probably null
R0244:Bace2 UTSW 16 97,237,973 (GRCm39) splice site probably null
R0674:Bace2 UTSW 16 97,237,949 (GRCm39) missense possibly damaging 0.93
R0906:Bace2 UTSW 16 97,158,141 (GRCm39) missense possibly damaging 0.67
R1078:Bace2 UTSW 16 97,158,060 (GRCm39) missense unknown
R1670:Bace2 UTSW 16 97,213,335 (GRCm39) missense probably damaging 0.96
R1997:Bace2 UTSW 16 97,216,289 (GRCm39) missense possibly damaging 0.93
R2050:Bace2 UTSW 16 97,213,336 (GRCm39) missense probably damaging 1.00
R2937:Bace2 UTSW 16 97,213,388 (GRCm39) critical splice donor site probably null
R2938:Bace2 UTSW 16 97,213,388 (GRCm39) critical splice donor site probably null
R3103:Bace2 UTSW 16 97,223,201 (GRCm39) critical splice donor site probably null
R3755:Bace2 UTSW 16 97,237,857 (GRCm39) missense probably benign 0.34
R4110:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4112:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4113:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4560:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4562:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4563:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4717:Bace2 UTSW 16 97,238,073 (GRCm39) missense probably damaging 1.00
R5535:Bace2 UTSW 16 97,214,625 (GRCm39) missense probably damaging 1.00
R6282:Bace2 UTSW 16 97,216,297 (GRCm39) missense probably damaging 1.00
R6364:Bace2 UTSW 16 97,214,633 (GRCm39) missense probably benign 0.05
R7045:Bace2 UTSW 16 97,200,865 (GRCm39) missense probably damaging 1.00
R7241:Bace2 UTSW 16 97,237,998 (GRCm39) missense possibly damaging 0.92
R7546:Bace2 UTSW 16 97,200,882 (GRCm39) missense probably benign 0.01
R7653:Bace2 UTSW 16 97,237,852 (GRCm39) missense
R8171:Bace2 UTSW 16 97,225,786 (GRCm39) missense possibly damaging 0.86
R8324:Bace2 UTSW 16 97,158,108 (GRCm39) missense possibly damaging 0.51
R8341:Bace2 UTSW 16 97,158,108 (GRCm39) missense possibly damaging 0.51
R8480:Bace2 UTSW 16 97,214,670 (GRCm39) missense probably damaging 1.00
R9205:Bace2 UTSW 16 97,158,059 (GRCm39) missense unknown
R9221:Bace2 UTSW 16 97,209,692 (GRCm39) missense probably benign 0.01
X0024:Bace2 UTSW 16 97,214,598 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACGGAAGACATAGCCAG -3'
(R):5'- ACTGTTTTGGTTCACAATGAGG -3'

Sequencing Primer
(F):5'- GACATAGCCAGCAACTGTGTTC -3'
(R):5'- TCAAGAGTAATCAAGATACAGTCTGG -3'
Posted On 2020-01-23