Incidental Mutation 'R8027:Abhd18'
ID617752
Institutional Source Beutler Lab
Gene Symbol Abhd18
Ensembl Gene ENSMUSG00000037818
Gene Nameabhydrolase domain containing 18
Synonyms3110057O12Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R8027 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location40846970-40938138 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 40933723 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 334 (T334I)
Ref Sequence ENSEMBL: ENSMUSP00000103712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108077] [ENSMUST00000108078] [ENSMUST00000159774] [ENSMUST00000204496] [ENSMUST00000205065]
Predicted Effect probably benign
Transcript: ENSMUST00000108077
AA Change: T334I

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000103712
Gene: ENSMUSG00000037818
AA Change: T334I

DomainStartEndE-ValueType
Pfam:DUF2048 16 457 7.7e-168 PFAM
Pfam:Abhydrolase_6 91 445 1.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108078
AA Change: T334I

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000103713
Gene: ENSMUSG00000037818
AA Change: T334I

DomainStartEndE-ValueType
Pfam:DUF2048 16 457 7.7e-168 PFAM
Pfam:Abhydrolase_6 91 445 1.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159774
AA Change: T334I

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124430
Gene: ENSMUSG00000037818
AA Change: T334I

DomainStartEndE-ValueType
Pfam:DUF2048 16 457 1.3e-171 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204496
SMART Domains Protein: ENSMUSP00000145007
Gene: ENSMUSG00000037818

DomainStartEndE-ValueType
Pfam:DUF2048 16 67 2.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205065
SMART Domains Protein: ENSMUSP00000145095
Gene: ENSMUSG00000037818

DomainStartEndE-ValueType
Pfam:DUF2048 16 151 7.8e-65 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 T C 8: 24,782,558 N527S probably damaging Het
Aldh5a1 A T 13: 24,926,110 Y147* probably null Het
Astn2 A C 4: 65,540,971 V1121G possibly damaging Het
Atr T A 9: 95,865,756 Y364N probably damaging Het
AW549877 T C 15: 3,986,212 Q290R probably benign Het
Bmpr2 T A 1: 59,867,803 L685H probably damaging Het
C2cd5 A G 6: 143,078,320 L248P possibly damaging Het
Cog1 T C 11: 113,652,389 L241P probably damaging Het
Diexf A G 1: 193,118,222 V430A probably benign Het
Fam161a A T 11: 23,020,125 K101M probably damaging Het
Fancd2 C T 6: 113,546,622 T240I probably damaging Het
Fbxl8 C T 8: 105,268,126 T90I probably benign Het
Fndc3a A G 14: 72,553,543 V998A probably benign Het
Fut1 G A 7: 45,618,865 G81E probably damaging Het
Gapdh A G 6: 125,162,368 V285A probably benign Het
Gm12169 T C 11: 46,537,917 I222T probably benign Het
Gm5591 T C 7: 38,522,298 T116A probably damaging Het
Grhl2 A G 15: 37,279,483 E145G probably benign Het
Grik1 T G 16: 87,936,005 T660P Het
Gzmk T A 13: 113,171,900 K256* probably null Het
Hsp90b1 A G 10: 86,696,730 S361P probably damaging Het
Inpp5f T C 7: 128,690,673 S645P probably damaging Het
Izumo1 T C 7: 45,626,254 V329A probably benign Het
Leng8 CT C 7: 4,142,856 probably null Het
Lrba T A 3: 86,417,912 D1892E probably benign Het
Lztr1 T C 16: 17,512,112 S101P probably damaging Het
Mark4 T C 7: 19,447,239 D145G possibly damaging Het
Olfr545 T A 7: 102,494,422 I118F probably damaging Het
Pcdhb9 T C 18: 37,403,016 S688P possibly damaging Het
Prpf40a A G 2: 53,191,138 M17T probably benign Het
Psg29 G A 7: 17,208,640 V189M possibly damaging Het
Ptprm T C 17: 66,944,205 Y559C probably damaging Het
Scn10a T C 9: 119,633,790 Y1060C probably damaging Het
Sh3pxd2b C T 11: 32,422,210 T459M probably benign Het
Skint4 G T 4: 112,157,985 probably null Het
Skint8 T A 4: 111,928,739 D127E probably benign Het
Slc13a2 T A 11: 78,404,756 M95L probably benign Het
Slc5a2 A G 7: 128,270,546 M384V probably damaging Het
Srrt ACCTTCTCCCCAGAACCCCACACCTTACCTGGCCT ACCT 5: 137,302,499 probably null Het
Tmem198 A T 1: 75,480,062 probably benign Het
Ttn A G 2: 76,896,716 I5835T unknown Het
Tulp3 T C 6: 128,334,473 D73G probably benign Het
Ube2e2 A C 14: 18,574,317 W195G possibly damaging Het
Wwp2 C A 8: 107,555,477 H768N probably damaging Het
Other mutations in Abhd18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Abhd18 APN 3 40933642 missense probably benign 0.00
IGL01785:Abhd18 APN 3 40905904 missense probably damaging 1.00
IGL02318:Abhd18 APN 3 40930227 critical splice donor site probably null
IGL02447:Abhd18 APN 3 40933773 missense probably benign
IGL02823:Abhd18 APN 3 40933518 splice site probably benign
IGL03023:Abhd18 APN 3 40904984 missense probably damaging 0.98
F2404:Abhd18 UTSW 3 40933878 missense probably damaging 0.99
R0064:Abhd18 UTSW 3 40933853 missense probably benign 0.00
R0064:Abhd18 UTSW 3 40933853 missense probably benign 0.00
R0494:Abhd18 UTSW 3 40916688 missense probably damaging 1.00
R1994:Abhd18 UTSW 3 40934926 nonsense probably null
R2206:Abhd18 UTSW 3 40910573 missense probably benign 0.00
R2223:Abhd18 UTSW 3 40934861 splice site probably benign
R2698:Abhd18 UTSW 3 40930966 missense probably benign 0.03
R3406:Abhd18 UTSW 3 40904903 start codon destroyed probably null 1.00
R3747:Abhd18 UTSW 3 40933573 missense probably benign
R4899:Abhd18 UTSW 3 40905869 splice site probably null
R5259:Abhd18 UTSW 3 40916890 missense probably damaging 1.00
R5673:Abhd18 UTSW 3 40923451 missense probably damaging 1.00
R5713:Abhd18 UTSW 3 40934979 nonsense probably null
R5797:Abhd18 UTSW 3 40933551 missense probably benign 0.08
R5983:Abhd18 UTSW 3 40910544 missense probably damaging 1.00
R6333:Abhd18 UTSW 3 40933783 missense probably benign
R6980:Abhd18 UTSW 3 40933780 missense probably benign
R7085:Abhd18 UTSW 3 40916909 missense possibly damaging 0.90
R7091:Abhd18 UTSW 3 40916738 missense probably damaging 0.99
R7096:Abhd18 UTSW 3 40933870 missense probably damaging 1.00
R7168:Abhd18 UTSW 3 40934936 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACACGAGTTCATGAATCACTTGC -3'
(R):5'- AAATGTTCCAGATGTTCCCAGTTTC -3'

Sequencing Primer
(F):5'- GAGTTCATGAATCACTTGCCTAGC -3'
(R):5'- ACCTGAGAAGTTTGCTACGTGAGTAC -3'
Posted On2020-01-23