Incidental Mutation 'R8027:Astn2'
ID617754
Institutional Source Beutler Lab
Gene Symbol Astn2
Ensembl Gene ENSMUSG00000028373
Gene Nameastrotactin 2
Synonyms1d8, Astnl
Accession Numbers

Genbank: NM_019514.3, NM_207109.2; Ensembl: ENSMUST00000068214,   ENSMUST00000084496

Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R8027 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location65380803-66404611 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 65540971 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 1121 (V1121G)
Ref Sequence ENSEMBL: ENSMUSP00000065786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068214] [ENSMUST00000084496]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068214
AA Change: V1121G

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000065786
Gene: ENSMUSG00000028373
AA Change: V1121G

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 87 127 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
low complexity region 303 312 N/A INTRINSIC
low complexity region 342 361 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 432 437 N/A INTRINSIC
transmembrane domain 443 465 N/A INTRINSIC
EGF_like 526 563 2.92e1 SMART
Blast:EGF_like 667 708 2e-18 BLAST
EGF_like 715 764 4.03e1 SMART
MACPF 864 1048 2.88e-55 SMART
FN3 1079 1191 2.41e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000084496
AA Change: V1069G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000081540
Gene: ENSMUSG00000028373
AA Change: V1069G

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 87 127 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
low complexity region 303 312 N/A INTRINSIC
low complexity region 341 352 N/A INTRINSIC
low complexity region 380 385 N/A INTRINSIC
transmembrane domain 391 413 N/A INTRINSIC
EGF_like 474 511 2.92e1 SMART
Blast:EGF_like 615 656 2e-18 BLAST
EGF_like 663 712 4.03e1 SMART
MACPF 812 996 2.88e-55 SMART
FN3 1027 1139 2.41e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is expressed in the brain and may function in neuronal migration, based on functional studies of the related astrotactin 1 gene in human and mouse. A deletion at this locus has been associated with schizophrenia. Multiple transcript variants encoding different proteins have been found for this locus. [provided by RefSeq, May 2010]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 C T 3: 40,933,723 T334I probably benign Het
Adam5 T C 8: 24,782,558 N527S probably damaging Het
Aldh5a1 A T 13: 24,926,110 Y147* probably null Het
Atr T A 9: 95,865,756 Y364N probably damaging Het
AW549877 T C 15: 3,986,212 Q290R probably benign Het
Bmpr2 T A 1: 59,867,803 L685H probably damaging Het
C2cd5 A G 6: 143,078,320 L248P possibly damaging Het
Cog1 T C 11: 113,652,389 L241P probably damaging Het
Diexf A G 1: 193,118,222 V430A probably benign Het
Fam161a A T 11: 23,020,125 K101M probably damaging Het
Fancd2 C T 6: 113,546,622 T240I probably damaging Het
Fbxl8 C T 8: 105,268,126 T90I probably benign Het
Fndc3a A G 14: 72,553,543 V998A probably benign Het
Fut1 G A 7: 45,618,865 G81E probably damaging Het
Gapdh A G 6: 125,162,368 V285A probably benign Het
Gm12169 T C 11: 46,537,917 I222T probably benign Het
Gm5591 T C 7: 38,522,298 T116A probably damaging Het
Grhl2 A G 15: 37,279,483 E145G probably benign Het
Grik1 T G 16: 87,936,005 T660P Het
Gzmk T A 13: 113,171,900 K256* probably null Het
Hsp90b1 A G 10: 86,696,730 S361P probably damaging Het
Inpp5f T C 7: 128,690,673 S645P probably damaging Het
Izumo1 T C 7: 45,626,254 V329A probably benign Het
Leng8 CT C 7: 4,142,856 probably null Het
Lrba T A 3: 86,417,912 D1892E probably benign Het
Lztr1 T C 16: 17,512,112 S101P probably damaging Het
Mark4 T C 7: 19,447,239 D145G possibly damaging Het
Olfr545 T A 7: 102,494,422 I118F probably damaging Het
Pcdhb9 T C 18: 37,403,016 S688P possibly damaging Het
Prpf40a A G 2: 53,191,138 M17T probably benign Het
Psg29 G A 7: 17,208,640 V189M possibly damaging Het
Ptprm T C 17: 66,944,205 Y559C probably damaging Het
Scn10a T C 9: 119,633,790 Y1060C probably damaging Het
Sh3pxd2b C T 11: 32,422,210 T459M probably benign Het
Skint4 G T 4: 112,157,985 probably null Het
Skint8 T A 4: 111,928,739 D127E probably benign Het
Slc13a2 T A 11: 78,404,756 M95L probably benign Het
Slc5a2 A G 7: 128,270,546 M384V probably damaging Het
Srrt ACCTTCTCCCCAGAACCCCACACCTTACCTGGCCT ACCT 5: 137,302,499 probably null Het
Tmem198 A T 1: 75,480,062 probably benign Het
Ttn A G 2: 76,896,716 I5835T unknown Het
Tulp3 T C 6: 128,334,473 D73G probably benign Het
Ube2e2 A C 14: 18,574,317 W195G possibly damaging Het
Wwp2 C A 8: 107,555,477 H768N probably damaging Het
Other mutations in Astn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Astn2 APN 4 66185187 missense unknown
IGL01657:Astn2 APN 4 65651949 missense probably damaging 0.99
IGL01747:Astn2 APN 4 65794618 missense probably benign 0.17
IGL02008:Astn2 APN 4 66059153 missense probably damaging 1.00
IGL02215:Astn2 APN 4 66266234 missense unknown
IGL02484:Astn2 APN 4 65992279 splice site probably benign
IGL02494:Astn2 APN 4 65992348 missense probably benign 0.23
IGL02792:Astn2 APN 4 65644821 missense probably benign 0.32
IGL03248:Astn2 APN 4 65746293 splice site probably benign
IGL03409:Astn2 APN 4 65435186 missense possibly damaging 0.46
B6584:Astn2 UTSW 4 65992387 missense probably damaging 0.99
R0015:Astn2 UTSW 4 66266382 critical splice acceptor site probably null
R0015:Astn2 UTSW 4 66266382 critical splice acceptor site probably null
R0092:Astn2 UTSW 4 66403982 missense unknown
R0245:Astn2 UTSW 4 65794558 missense probably damaging 0.99
R0528:Astn2 UTSW 4 65644882 splice site probably benign
R0586:Astn2 UTSW 4 66185142 missense unknown
R0652:Astn2 UTSW 4 65794558 missense probably damaging 0.99
R0880:Astn2 UTSW 4 65648330 missense probably damaging 0.99
R0931:Astn2 UTSW 4 65648293 missense probably damaging 0.99
R1353:Astn2 UTSW 4 66266335 missense unknown
R1700:Astn2 UTSW 4 65746354 nonsense probably null
R1934:Astn2 UTSW 4 65435189 missense probably damaging 0.99
R2017:Astn2 UTSW 4 65540941 missense probably damaging 0.99
R2101:Astn2 UTSW 4 65581686 nonsense probably null
R2158:Astn2 UTSW 4 66404254 missense unknown
R2907:Astn2 UTSW 4 65644856 missense possibly damaging 0.92
R2923:Astn2 UTSW 4 65913773 missense probably damaging 1.00
R2938:Astn2 UTSW 4 65992313 missense possibly damaging 0.92
R3033:Astn2 UTSW 4 65644706 missense probably damaging 1.00
R3933:Astn2 UTSW 4 66403955 missense unknown
R4151:Astn2 UTSW 4 65729320 critical splice donor site probably null
R4230:Astn2 UTSW 4 65911682 missense probably damaging 0.99
R4497:Astn2 UTSW 4 66119063 intron probably benign
R4717:Astn2 UTSW 4 65644754 missense possibly damaging 0.86
R4844:Astn2 UTSW 4 65644730 missense possibly damaging 0.90
R4928:Astn2 UTSW 4 65729407 missense probably damaging 0.98
R5374:Astn2 UTSW 4 65397005 missense probably damaging 0.96
R5442:Astn2 UTSW 4 65581786 missense possibly damaging 0.86
R5694:Astn2 UTSW 4 65950138 missense probably damaging 1.00
R5756:Astn2 UTSW 4 66119188 intron probably benign
R5763:Astn2 UTSW 4 65729331 missense probably benign 0.14
R6089:Astn2 UTSW 4 65794573 missense probably damaging 0.96
R6990:Astn2 UTSW 4 65992303 missense possibly damaging 0.82
R7304:Astn2 UTSW 4 66185375 missense unknown
R7325:Astn2 UTSW 4 65542669 missense probably benign 0.33
R7356:Astn2 UTSW 4 66185266 missense unknown
R7414:Astn2 UTSW 4 65540956 missense possibly damaging 0.85
R7755:Astn2 UTSW 4 65794558 missense probably damaging 0.99
R7887:Astn2 UTSW 4 65644866 missense possibly damaging 0.51
R7970:Astn2 UTSW 4 65644866 missense possibly damaging 0.51
R8046:Astn2 UTSW 4 66266350 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGACTGCCCATATCAGAGGAG -3'
(R):5'- AACTGTAGGTCTTTAGGGCCC -3'

Sequencing Primer
(F):5'- GCCCATATCAGAGGAGCTCTTC -3'
(R):5'- CTTTAGGGCCCTGGATGATACAAGAC -3'
Posted On2020-01-23