Incidental Mutation 'R8027:Srrt'
ID617757
Institutional Source Beutler Lab
Gene Symbol Srrt
Ensembl Gene ENSMUSG00000037364
Gene Nameserrate RNA effector molecule homolog (Arabidopsis)
Synonyms2810019G02Rik, Asr2, Ars2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8027 (G1)
Quality Score217.468
Status Not validated
Chromosome5
Chromosomal Location137295704-137307674 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) ACCTTCTCCCCAGAACCCCACACCTTACCTGGCCT to ACCT at 137302499 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040873] [ENSMUST00000196109] [ENSMUST00000197466] [ENSMUST00000197484] [ENSMUST00000198526] [ENSMUST00000199243]
Predicted Effect probably null
Transcript: ENSMUST00000040873
SMART Domains Protein: ENSMUSP00000043123
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 153 262 3.8e-44 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 645 850 9.7e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196109
SMART Domains Protein: ENSMUSP00000142351
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
Blast:RRM 65 133 2e-15 BLAST
low complexity region 208 237 N/A INTRINSIC
low complexity region 245 257 N/A INTRINSIC
Pfam:ARS2 277 498 6.5e-111 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000197466
SMART Domains Protein: ENSMUSP00000142564
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 9.5e-48 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 635 845 5.5e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197484
SMART Domains Protein: ENSMUSP00000142660
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 41 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000198526
SMART Domains Protein: ENSMUSP00000142435
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 2e-45 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 369 408 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000199243
SMART Domains Protein: ENSMUSP00000143232
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 9.5e-48 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 635 849 9.8e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199365
Predicted Effect probably benign
Transcript: ENSMUST00000199605
Predicted Effect probably benign
Transcript: ENSMUST00000223263
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display embryonic lethality before somite formation, increased apoptosis, and when cultured most fail to hatch from the zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 C T 3: 40,933,723 T334I probably benign Het
Adam5 T C 8: 24,782,558 N527S probably damaging Het
Aldh5a1 A T 13: 24,926,110 Y147* probably null Het
Astn2 A C 4: 65,540,971 V1121G possibly damaging Het
Atr T A 9: 95,865,756 Y364N probably damaging Het
AW549877 T C 15: 3,986,212 Q290R probably benign Het
Bmpr2 T A 1: 59,867,803 L685H probably damaging Het
C2cd5 A G 6: 143,078,320 L248P possibly damaging Het
Cog1 T C 11: 113,652,389 L241P probably damaging Het
Diexf A G 1: 193,118,222 V430A probably benign Het
Fam161a A T 11: 23,020,125 K101M probably damaging Het
Fancd2 C T 6: 113,546,622 T240I probably damaging Het
Fbxl8 C T 8: 105,268,126 T90I probably benign Het
Fndc3a A G 14: 72,553,543 V998A probably benign Het
Fut1 G A 7: 45,618,865 G81E probably damaging Het
Gapdh A G 6: 125,162,368 V285A probably benign Het
Gm12169 T C 11: 46,537,917 I222T probably benign Het
Gm5591 T C 7: 38,522,298 T116A probably damaging Het
Grhl2 A G 15: 37,279,483 E145G probably benign Het
Grik1 T G 16: 87,936,005 T660P Het
Gzmk T A 13: 113,171,900 K256* probably null Het
Hsp90b1 A G 10: 86,696,730 S361P probably damaging Het
Inpp5f T C 7: 128,690,673 S645P probably damaging Het
Izumo1 T C 7: 45,626,254 V329A probably benign Het
Leng8 CT C 7: 4,142,856 probably null Het
Lrba T A 3: 86,417,912 D1892E probably benign Het
Lztr1 T C 16: 17,512,112 S101P probably damaging Het
Mark4 T C 7: 19,447,239 D145G possibly damaging Het
Olfr545 T A 7: 102,494,422 I118F probably damaging Het
Pcdhb9 T C 18: 37,403,016 S688P possibly damaging Het
Prpf40a A G 2: 53,191,138 M17T probably benign Het
Psg29 G A 7: 17,208,640 V189M possibly damaging Het
Ptprm T C 17: 66,944,205 Y559C probably damaging Het
Scn10a T C 9: 119,633,790 Y1060C probably damaging Het
Sh3pxd2b C T 11: 32,422,210 T459M probably benign Het
Skint4 G T 4: 112,157,985 probably null Het
Skint8 T A 4: 111,928,739 D127E probably benign Het
Slc13a2 T A 11: 78,404,756 M95L probably benign Het
Slc5a2 A G 7: 128,270,546 M384V probably damaging Het
Tmem198 A T 1: 75,480,062 probably benign Het
Ttn A G 2: 76,896,716 I5835T unknown Het
Tulp3 T C 6: 128,334,473 D73G probably benign Het
Ube2e2 A C 14: 18,574,317 W195G possibly damaging Het
Wwp2 C A 8: 107,555,477 H768N probably damaging Het
Other mutations in Srrt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Srrt APN 5 137295978 unclassified probably benign
IGL01062:Srrt APN 5 137296307 missense probably damaging 1.00
IGL02227:Srrt APN 5 137296274 missense probably damaging 1.00
IGL02656:Srrt APN 5 137299676 unclassified probably benign
IGL03105:Srrt APN 5 137299844 missense possibly damaging 0.72
IGL03137:Srrt APN 5 137296117 unclassified probably benign
R0281:Srrt UTSW 5 137296127 unclassified probably benign
R0322:Srrt UTSW 5 137296608 missense probably damaging 1.00
R0347:Srrt UTSW 5 137299676 unclassified probably benign
R1253:Srrt UTSW 5 137300336 missense probably benign 0.01
R1397:Srrt UTSW 5 137300261 missense possibly damaging 0.89
R1520:Srrt UTSW 5 137298766 missense probably damaging 0.99
R1561:Srrt UTSW 5 137300019 missense probably benign 0.24
R1645:Srrt UTSW 5 137302139 nonsense probably null
R1759:Srrt UTSW 5 137302950 missense probably damaging 1.00
R1770:Srrt UTSW 5 137299860 unclassified probably benign
R1795:Srrt UTSW 5 137303012 unclassified probably benign
R1848:Srrt UTSW 5 137296945 missense probably damaging 1.00
R3838:Srrt UTSW 5 137302125 critical splice donor site probably null
R5015:Srrt UTSW 5 137296009 missense probably damaging 1.00
R5068:Srrt UTSW 5 137296541 missense possibly damaging 0.93
R5163:Srrt UTSW 5 137296773 critical splice donor site probably null
R5316:Srrt UTSW 5 137296551 missense probably benign 0.16
R5343:Srrt UTSW 5 137297165 missense probably damaging 1.00
R5351:Srrt UTSW 5 137298284 makesense probably null
R5412:Srrt UTSW 5 137296287 missense probably damaging 1.00
R5806:Srrt UTSW 5 137297917 missense probably damaging 0.98
R6470:Srrt UTSW 5 137302656 missense probably damaging 1.00
R6497:Srrt UTSW 5 137297506 missense probably damaging 1.00
R6755:Srrt UTSW 5 137302930 missense probably damaging 1.00
R6828:Srrt UTSW 5 137296968 missense probably damaging 1.00
R6875:Srrt UTSW 5 137298673 missense probably benign 0.00
R7586:Srrt UTSW 5 137302195 missense probably damaging 0.98
R7677:Srrt UTSW 5 137300148 missense probably damaging 0.99
RF018:Srrt UTSW 5 137300000 missense probably benign 0.23
Z1176:Srrt UTSW 5 137298227 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCAATCACAAAGGCTTGCTTG -3'
(R):5'- AGACCATATCCTCCGTGTGC -3'

Sequencing Primer
(F):5'- TTGTGAGCAAGACGGAGAGCC -3'
(R):5'- GGAGAGGTAGCTTTAGTTCCTTC -3'
Posted On2020-01-23