Incidental Mutation 'R8027:Fancd2'
ID617758
Institutional Source Beutler Lab
Gene Symbol Fancd2
Ensembl Gene ENSMUSG00000034023
Gene NameFanconi anemia, complementation group D2
Synonyms2410150O07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8027 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location113531682-113597017 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 113546622 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 240 (T240I)
Ref Sequence ENSEMBL: ENSMUSP00000045667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036340] [ENSMUST00000204827]
PDB Structure Structure of the FANCI-FANCD2 complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000036340
AA Change: T240I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045667
Gene: ENSMUSG00000034023
AA Change: T240I

DomainStartEndE-ValueType
Pfam:FancD2 1 1415 N/A PFAM
low complexity region 1430 1450 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204827
AA Change: T240I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144928
Gene: ENSMUSG00000034023
AA Change: T240I

DomainStartEndE-ValueType
Pfam:FancD2 1 1402 N/A PFAM
low complexity region 1417 1437 N/A INTRINSIC
Meta Mutation Damage Score 0.3153 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group D2. This protein is monoubiquinated in response to DNA damage, resulting in its localization to nuclear foci with other proteins (BRCA1 AND BRCA2) involved in homology-directed DNA repair. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutant mice exhibit defects observed in human patients with Fanconi anemia (FA) meiotic defects and germ cell loss. In addition, mutant mice display perinatal lethality, susceptiblity ot epithelial cancer, and microphthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 C T 3: 40,933,723 T334I probably benign Het
Adam5 T C 8: 24,782,558 N527S probably damaging Het
Aldh5a1 A T 13: 24,926,110 Y147* probably null Het
Astn2 A C 4: 65,540,971 V1121G possibly damaging Het
Atr T A 9: 95,865,756 Y364N probably damaging Het
AW549877 T C 15: 3,986,212 Q290R probably benign Het
Bmpr2 T A 1: 59,867,803 L685H probably damaging Het
C2cd5 A G 6: 143,078,320 L248P possibly damaging Het
Calcoco2 A T 11: 96,100,415 probably benign Het
Cog1 T C 11: 113,652,389 L241P probably damaging Het
Diexf A G 1: 193,118,222 V430A probably benign Het
Fam107a A T 14: 8,298,813 probably benign Het
Fam161a A T 11: 23,020,125 K101M probably damaging Het
Fbxl8 C T 8: 105,268,126 T90I probably benign Het
Fndc3a A G 14: 72,553,543 V998A probably benign Het
Fut1 G A 7: 45,618,865 G81E probably damaging Het
Gapdh A G 6: 125,162,368 V285A probably benign Het
Gm12169 T C 11: 46,537,917 I222T probably benign Het
Gm5591 T C 7: 38,522,298 T116A probably damaging Het
Grhl2 A G 15: 37,279,483 E145G probably benign Het
Grik1 T G 16: 87,936,005 T660P Het
Gzmk T A 13: 113,171,900 K256* probably null Het
Hsp90b1 A G 10: 86,696,730 S361P probably damaging Het
Inpp5f T C 7: 128,690,673 S645P probably damaging Het
Izumo1 T C 7: 45,626,254 V329A probably benign Het
Leng8 CT C 7: 4,142,856 probably null Het
Lrba T A 3: 86,417,912 D1892E probably benign Het
Lztr1 T C 16: 17,512,112 S101P probably damaging Het
Mark4 T C 7: 19,447,239 D145G possibly damaging Het
Nudt9 T A 5: 104,064,927 probably benign Het
Olfr545 T A 7: 102,494,422 I118F probably damaging Het
Pcdhb9 T C 18: 37,403,016 S688P possibly damaging Het
Prpf40a A G 2: 53,191,138 M17T probably benign Het
Psg29 G A 7: 17,208,640 V189M possibly damaging Het
Ptprm T C 17: 66,944,205 Y559C probably damaging Het
Scn10a T C 9: 119,633,790 Y1060C probably damaging Het
Sh3pxd2b C T 11: 32,422,210 T459M probably benign Het
Skint4 G T 4: 112,157,985 probably null Het
Skint8 T A 4: 111,928,739 D127E probably benign Het
Slc13a2 T A 11: 78,404,756 M95L probably benign Het
Slc5a2 A G 7: 128,270,546 M384V probably damaging Het
Tmem198 A T 1: 75,480,062 probably benign Het
Ttn A G 2: 76,896,716 I5835T unknown Het
Tulp3 T C 6: 128,334,473 D73G probably benign Het
Ube2e2 A C 14: 18,574,317 W195G possibly damaging Het
Wwp2 C A 8: 107,555,477 H768N probably damaging Het
Other mutations in Fancd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Fancd2 APN 6 113564396 critical splice donor site probably null
IGL00475:Fancd2 APN 6 113568610 missense probably benign 0.01
IGL01319:Fancd2 APN 6 113584899 missense probably damaging 0.98
IGL01339:Fancd2 APN 6 113553752 missense probably benign 0.00
IGL01373:Fancd2 APN 6 113553752 missense probably benign 0.00
IGL01393:Fancd2 APN 6 113577360 splice site probably benign
IGL01630:Fancd2 APN 6 113563124 missense probably damaging 1.00
IGL01769:Fancd2 APN 6 113545111 missense possibly damaging 0.90
IGL01882:Fancd2 APN 6 113546640 missense probably benign 0.05
IGL02029:Fancd2 APN 6 113570975 missense probably benign 0.44
IGL02224:Fancd2 APN 6 113568320 critical splice donor site probably null
IGL02271:Fancd2 APN 6 113535759 splice site probably benign
IGL02352:Fancd2 APN 6 113563112 missense probably damaging 1.00
IGL02359:Fancd2 APN 6 113563112 missense probably damaging 1.00
IGL02427:Fancd2 APN 6 113549352 splice site probably null
IGL02512:Fancd2 APN 6 113570943 missense probably damaging 1.00
IGL02530:Fancd2 APN 6 113562461 missense probably damaging 1.00
IGL02801:Fancd2 APN 6 113593317 missense probably benign 0.00
IGL03090:Fancd2 APN 6 113537597 splice site probably null
IGL03247:Fancd2 APN 6 113568208 missense probably benign 0.03
R0278:Fancd2 UTSW 6 113548448 critical splice donor site probably null
R0401:Fancd2 UTSW 6 113548343 missense possibly damaging 0.46
R0420:Fancd2 UTSW 6 113536979 missense probably damaging 0.98
R0496:Fancd2 UTSW 6 113555130 splice site probably benign
R0762:Fancd2 UTSW 6 113574658 missense probably benign 0.20
R0827:Fancd2 UTSW 6 113586249 critical splice donor site probably null
R1225:Fancd2 UTSW 6 113535861 missense probably damaging 0.99
R1576:Fancd2 UTSW 6 113578405 missense probably damaging 0.98
R2010:Fancd2 UTSW 6 113593291 missense probably damaging 0.96
R2079:Fancd2 UTSW 6 113555187 missense probably damaging 1.00
R2118:Fancd2 UTSW 6 113560074 splice site probably benign
R2141:Fancd2 UTSW 6 113549321 missense probably benign 0.00
R2168:Fancd2 UTSW 6 113591159 missense possibly damaging 0.92
R2180:Fancd2 UTSW 6 113574637 missense probably benign 0.33
R3016:Fancd2 UTSW 6 113536726 missense probably benign 0.00
R3153:Fancd2 UTSW 6 113593269 missense possibly damaging 0.55
R3154:Fancd2 UTSW 6 113593269 missense possibly damaging 0.55
R3783:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R3786:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R3787:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R4379:Fancd2 UTSW 6 113561716 missense probably benign 0.00
R4388:Fancd2 UTSW 6 113556368 missense probably damaging 0.99
R4544:Fancd2 UTSW 6 113572642 critical splice acceptor site probably null
R4598:Fancd2 UTSW 6 113585477 missense probably benign 0.06
R4832:Fancd2 UTSW 6 113553722 missense probably benign 0.16
R4841:Fancd2 UTSW 6 113562430 missense probably damaging 1.00
R4922:Fancd2 UTSW 6 113585473 missense probably benign 0.03
R5375:Fancd2 UTSW 6 113568712 missense possibly damaging 0.93
R5579:Fancd2 UTSW 6 113560051 critical splice acceptor site probably null
R5782:Fancd2 UTSW 6 113548872 missense probably benign 0.00
R5871:Fancd2 UTSW 6 113556282 missense probably benign 0.30
R5901:Fancd2 UTSW 6 113549365 missense probably damaging 1.00
R5909:Fancd2 UTSW 6 113561711 missense probably benign
R6026:Fancd2 UTSW 6 113551770 missense possibly damaging 0.46
R6166:Fancd2 UTSW 6 113555251 missense possibly damaging 0.67
R6393:Fancd2 UTSW 6 113578413 missense probably benign 0.01
R6666:Fancd2 UTSW 6 113585509 missense probably damaging 0.96
R6669:Fancd2 UTSW 6 113593327 missense probably benign 0.00
R6676:Fancd2 UTSW 6 113537665 nonsense probably null
R6762:Fancd2 UTSW 6 113586016 splice site probably null
R6911:Fancd2 UTSW 6 113548385 missense probably damaging 0.98
R6992:Fancd2 UTSW 6 113571018 critical splice donor site probably null
R7091:Fancd2 UTSW 6 113545101 missense probably damaging 1.00
R7252:Fancd2 UTSW 6 113556285 missense probably damaging 0.98
R7343:Fancd2 UTSW 6 113536939 missense probably benign 0.01
R7344:Fancd2 UTSW 6 113568709 missense probably benign 0.09
R7354:Fancd2 UTSW 6 113595946 missense unknown
R7489:Fancd2 UTSW 6 113564304 missense probably benign
R7501:Fancd2 UTSW 6 113548403 missense possibly damaging 0.95
R7504:Fancd2 UTSW 6 113545038 missense probably damaging 1.00
R7992:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R8487:Fancd2 UTSW 6 113568226 missense probably damaging 1.00
R8509:Fancd2 UTSW 6 113572570 missense probably benign 0.00
R8757:Fancd2 UTSW 6 113560093 missense possibly damaging 0.91
R8960:Fancd2 UTSW 6 113563168 critical splice donor site probably null
Z1088:Fancd2 UTSW 6 113581422 missense probably benign 0.00
Z1177:Fancd2 UTSW 6 113545025 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGCAGGTCCAAGACATC -3'
(R):5'- ATCCCCGTGATGATGATGC -3'

Sequencing Primer
(F):5'- CTCCATGAGATCCAGCTGTAAGG -3'
(R):5'- CCGTGATGATGATGCCATGTTTTTG -3'
Posted On2020-01-23