Incidental Mutation 'R8027:Mark4'
ID617764
Institutional Source Beutler Lab
Gene Symbol Mark4
Ensembl Gene ENSMUSG00000030397
Gene NameMAP/microtubule affinity regulating kinase 4
SynonymsMarkl1, 2410090P21Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8027 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location19424775-19458821 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19447239 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 145 (D145G)
Ref Sequence ENSEMBL: ENSMUSP00000082862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085715] [ENSMUST00000209058]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085715
AA Change: D145G

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000082862
Gene: ENSMUSG00000030397
AA Change: D145G

DomainStartEndE-ValueType
S_TKc 59 310 1.4e-109 SMART
UBA 331 368 9.62e-8 SMART
low complexity region 391 408 N/A INTRINSIC
low complexity region 463 474 N/A INTRINSIC
low complexity region 540 553 N/A INTRINSIC
low complexity region 580 586 N/A INTRINSIC
low complexity region 672 690 N/A INTRINSIC
Pfam:KA1 709 752 1.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209058
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule affinity-regulating kinase family. These protein kinases phosphorylate microtubule-associated proteins and regulate the transition between stable and dynamic microtubules. The encoded protein is associated with the centrosome throughout mitosis and may be involved in cell cycle control. Expression of this gene is a potential marker for cancer, and the encoded protein may also play a role in Alzheimer's disease. Pseudogenes of this gene are located on both the short and long arm of chromosome 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit insulin hypersensitivity and resistance to diet-induced obersity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 C T 3: 40,933,723 T334I probably benign Het
Adam5 T C 8: 24,782,558 N527S probably damaging Het
Aldh5a1 A T 13: 24,926,110 Y147* probably null Het
Astn2 A C 4: 65,540,971 V1121G possibly damaging Het
Atr T A 9: 95,865,756 Y364N probably damaging Het
AW549877 T C 15: 3,986,212 Q290R probably benign Het
Bmpr2 T A 1: 59,867,803 L685H probably damaging Het
C2cd5 A G 6: 143,078,320 L248P possibly damaging Het
Cog1 T C 11: 113,652,389 L241P probably damaging Het
Diexf A G 1: 193,118,222 V430A probably benign Het
Fam161a A T 11: 23,020,125 K101M probably damaging Het
Fancd2 C T 6: 113,546,622 T240I probably damaging Het
Fbxl8 C T 8: 105,268,126 T90I probably benign Het
Fndc3a A G 14: 72,553,543 V998A probably benign Het
Fut1 G A 7: 45,618,865 G81E probably damaging Het
Gapdh A G 6: 125,162,368 V285A probably benign Het
Gm12169 T C 11: 46,537,917 I222T probably benign Het
Gm5591 T C 7: 38,522,298 T116A probably damaging Het
Grhl2 A G 15: 37,279,483 E145G probably benign Het
Grik1 T G 16: 87,936,005 T660P Het
Gzmk T A 13: 113,171,900 K256* probably null Het
Hsp90b1 A G 10: 86,696,730 S361P probably damaging Het
Inpp5f T C 7: 128,690,673 S645P probably damaging Het
Izumo1 T C 7: 45,626,254 V329A probably benign Het
Leng8 CT C 7: 4,142,856 probably null Het
Lrba T A 3: 86,417,912 D1892E probably benign Het
Lztr1 T C 16: 17,512,112 S101P probably damaging Het
Olfr545 T A 7: 102,494,422 I118F probably damaging Het
Pcdhb9 T C 18: 37,403,016 S688P possibly damaging Het
Prpf40a A G 2: 53,191,138 M17T probably benign Het
Psg29 G A 7: 17,208,640 V189M possibly damaging Het
Ptprm T C 17: 66,944,205 Y559C probably damaging Het
Scn10a T C 9: 119,633,790 Y1060C probably damaging Het
Sh3pxd2b C T 11: 32,422,210 T459M probably benign Het
Skint4 G T 4: 112,157,985 probably null Het
Skint8 T A 4: 111,928,739 D127E probably benign Het
Slc13a2 T A 11: 78,404,756 M95L probably benign Het
Slc5a2 A G 7: 128,270,546 M384V probably damaging Het
Srrt ACCTTCTCCCCAGAACCCCACACCTTACCTGGCCT ACCT 5: 137,302,499 probably null Het
Tmem198 A T 1: 75,480,062 probably benign Het
Ttn A G 2: 76,896,716 I5835T unknown Het
Tulp3 T C 6: 128,334,473 D73G probably benign Het
Ube2e2 A C 14: 18,574,317 W195G possibly damaging Het
Wwp2 C A 8: 107,555,477 H768N probably damaging Het
Other mutations in Mark4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mark4 APN 7 19431824 missense possibly damaging 0.50
IGL02321:Mark4 APN 7 19426389 missense probably benign
IGL02813:Mark4 APN 7 19447256 splice site probably null
IGL03088:Mark4 APN 7 19451584 missense probably damaging 1.00
breakfast UTSW 7 19443226 missense probably damaging 1.00
Towncar UTSW 7 19447243 missense possibly damaging 0.95
R0555:Mark4 UTSW 7 19448673 splice site probably benign
R1278:Mark4 UTSW 7 19431770 missense probably damaging 0.99
R1385:Mark4 UTSW 7 19426027 unclassified probably null
R3415:Mark4 UTSW 7 19451725 missense probably benign 0.00
R3828:Mark4 UTSW 7 19443187 missense possibly damaging 0.65
R4281:Mark4 UTSW 7 19433446 missense probably benign 0.09
R4682:Mark4 UTSW 7 19445172 splice site probably null
R4791:Mark4 UTSW 7 19451657 missense probably benign 0.19
R5184:Mark4 UTSW 7 19447243 missense possibly damaging 0.95
R5319:Mark4 UTSW 7 19436961 missense possibly damaging 0.95
R5330:Mark4 UTSW 7 19436983 missense probably damaging 1.00
R5488:Mark4 UTSW 7 19429607 splice site probably null
R5811:Mark4 UTSW 7 19448639 missense probably damaging 1.00
R6058:Mark4 UTSW 7 19426385 missense probably benign 0.10
R6148:Mark4 UTSW 7 19429516 missense probably benign 0.00
R6333:Mark4 UTSW 7 19443283 missense probably damaging 0.98
R6698:Mark4 UTSW 7 19429437 missense probably benign 0.01
R7265:Mark4 UTSW 7 19451725 missense probably benign 0.00
R7429:Mark4 UTSW 7 19426167 missense probably damaging 0.99
R7664:Mark4 UTSW 7 19443226 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGCCATGCAGACTCCAGC -3'
(R):5'- TAGCGCAGGTGAAACTCTGC -3'

Sequencing Primer
(F):5'- ATGCAGACTCCAGCATTTTTC -3'
(R):5'- TGTGCCCTGCTCACACA -3'
Posted On2020-01-23