Incidental Mutation 'R8027:Adam5'
ID617771
Institutional Source Beutler Lab
Gene Symbol Adam5
Ensembl Gene ENSMUSG00000031554
Gene Namea disintegrin and metallopeptidase domain 5
SynonymstMDCII
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R8027 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location24727093-24824369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24782558 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 527 (N527S)
Ref Sequence ENSEMBL: ENSMUSP00000052661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050300] [ENSMUST00000118419] [ENSMUST00000209935]
Predicted Effect probably damaging
Transcript: ENSMUST00000050300
AA Change: N527S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052661
Gene: ENSMUSG00000031554
AA Change: N527S

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pep_M12B_propep 16 142 1.6e-19 PFAM
Pfam:Reprolysin 185 378 7.7e-59 PFAM
DISIN 397 474 9.1e-42 SMART
ACR 475 618 6.9e-58 SMART
transmembrane domain 695 712 N/A INTRINSIC
low complexity region 718 751 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118419
AA Change: N527S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112422
Gene: ENSMUSG00000031554
AA Change: N527S

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pep_M12B_propep 16 142 4.7e-30 PFAM
Pfam:Reprolysin 185 378 7.9e-56 PFAM
DISIN 397 474 1.78e-39 SMART
ACR 475 618 2.06e-55 SMART
transmembrane domain 695 712 N/A INTRINSIC
low complexity region 718 750 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000121272
Gene: ENSMUSG00000031554
AA Change: N444S

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 1 60 6.7e-14 PFAM
Pfam:Reprolysin 103 296 2.5e-61 PFAM
DISIN 315 392 1.78e-39 SMART
ACR 393 536 2.06e-55 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209935
AA Change: N527S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of related ADAM genes on chromosome 8. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 C T 3: 40,933,723 T334I probably benign Het
Aldh5a1 A T 13: 24,926,110 Y147* probably null Het
Astn2 A C 4: 65,540,971 V1121G possibly damaging Het
Atr T A 9: 95,865,756 Y364N probably damaging Het
AW549877 T C 15: 3,986,212 Q290R probably benign Het
Bmpr2 T A 1: 59,867,803 L685H probably damaging Het
C2cd5 A G 6: 143,078,320 L248P possibly damaging Het
Calcoco2 A T 11: 96,100,415 probably benign Het
Cog1 T C 11: 113,652,389 L241P probably damaging Het
Diexf A G 1: 193,118,222 V430A probably benign Het
Fam107a A T 14: 8,298,813 probably benign Het
Fam161a A T 11: 23,020,125 K101M probably damaging Het
Fancd2 C T 6: 113,546,622 T240I probably damaging Het
Fbxl8 C T 8: 105,268,126 T90I probably benign Het
Fndc3a A G 14: 72,553,543 V998A probably benign Het
Fut1 G A 7: 45,618,865 G81E probably damaging Het
Gapdh A G 6: 125,162,368 V285A probably benign Het
Gm12169 T C 11: 46,537,917 I222T probably benign Het
Gm5591 T C 7: 38,522,298 T116A probably damaging Het
Grhl2 A G 15: 37,279,483 E145G probably benign Het
Grik1 T G 16: 87,936,005 T660P Het
Gzmk T A 13: 113,171,900 K256* probably null Het
Hsp90b1 A G 10: 86,696,730 S361P probably damaging Het
Inpp5f T C 7: 128,690,673 S645P probably damaging Het
Izumo1 T C 7: 45,626,254 V329A probably benign Het
Leng8 CT C 7: 4,142,856 probably null Het
Lrba T A 3: 86,417,912 D1892E probably benign Het
Lztr1 T C 16: 17,512,112 S101P probably damaging Het
Mark4 T C 7: 19,447,239 D145G possibly damaging Het
Nudt9 T A 5: 104,064,927 probably benign Het
Olfr545 T A 7: 102,494,422 I118F probably damaging Het
Pcdhb9 T C 18: 37,403,016 S688P possibly damaging Het
Prpf40a A G 2: 53,191,138 M17T probably benign Het
Psg29 G A 7: 17,208,640 V189M possibly damaging Het
Ptprm T C 17: 66,944,205 Y559C probably damaging Het
Scn10a T C 9: 119,633,790 Y1060C probably damaging Het
Sh3pxd2b C T 11: 32,422,210 T459M probably benign Het
Skint4 G T 4: 112,157,985 probably null Het
Skint8 T A 4: 111,928,739 D127E probably benign Het
Slc13a2 T A 11: 78,404,756 M95L probably benign Het
Slc5a2 A G 7: 128,270,546 M384V probably damaging Het
Tmem198 A T 1: 75,480,062 probably benign Het
Ttn A G 2: 76,896,716 I5835T unknown Het
Tulp3 T C 6: 128,334,473 D73G probably benign Het
Ube2e2 A C 14: 18,574,317 W195G possibly damaging Het
Wwp2 C A 8: 107,555,477 H768N probably damaging Het
Other mutations in Adam5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Adam5 APN 8 24818742 missense probably benign 0.18
IGL01285:Adam5 APN 8 24781594 missense probably benign 0.02
IGL01310:Adam5 APN 8 24742134 intron probably benign
IGL01510:Adam5 APN 8 24804465 missense probably damaging 1.00
IGL01570:Adam5 APN 8 24810823 missense probably damaging 1.00
IGL02017:Adam5 APN 8 24781759 missense probably benign 0.38
IGL02191:Adam5 APN 8 24812423 nonsense probably null
IGL02397:Adam5 APN 8 24744133 intron probably benign
IGL02488:Adam5 APN 8 24792006 missense probably damaging 0.98
IGL02490:Adam5 APN 8 24781704 nonsense probably null
IGL02499:Adam5 APN 8 24781565 critical splice donor site probably null
IGL02539:Adam5 APN 8 24786213 nonsense probably null
IGL02590:Adam5 APN 8 24744135 intron probably benign
IGL02677:Adam5 APN 8 24812379 splice site probably benign
IGL02679:Adam5 APN 8 24806526 missense probably damaging 1.00
IGL02982:Adam5 APN 8 24804431 missense probably benign 0.02
IGL03146:Adam5 APN 8 24804503 missense probably damaging 0.98
IGL03162:Adam5 APN 8 24781604 missense probably benign 0.30
IGL03284:Adam5 APN 8 24786338 splice site probably benign
R0081:Adam5 UTSW 8 24781687 missense probably damaging 1.00
R0377:Adam5 UTSW 8 24747541 missense probably benign 0.08
R0398:Adam5 UTSW 8 24813432 missense probably benign 0.17
R0771:Adam5 UTSW 8 24786299 missense probably benign 0.04
R0925:Adam5 UTSW 8 24812425 missense probably benign 0.09
R1547:Adam5 UTSW 8 24810713 missense probably benign 0.10
R1985:Adam5 UTSW 8 24746739 missense probably benign 0.01
R2115:Adam5 UTSW 8 24744145 intron probably benign
R2125:Adam5 UTSW 8 24815118 missense probably damaging 1.00
R2144:Adam5 UTSW 8 24815480 missense probably benign 0.14
R3151:Adam5 UTSW 8 24781631 missense probably damaging 0.99
R3612:Adam5 UTSW 8 24818089 splice site probably benign
R3844:Adam5 UTSW 8 24813410 missense probably benign 0.12
R3873:Adam5 UTSW 8 24815109 missense probably benign 0.02
R4514:Adam5 UTSW 8 24818136 missense probably damaging 1.00
R4843:Adam5 UTSW 8 24813536 missense probably damaging 1.00
R4866:Adam5 UTSW 8 24742156 splice site probably null
R4866:Adam5 UTSW 8 24781603 missense probably damaging 0.98
R4900:Adam5 UTSW 8 24742156 splice site probably null
R4900:Adam5 UTSW 8 24781603 missense probably damaging 0.98
R4903:Adam5 UTSW 8 24786232 missense probably damaging 1.00
R4936:Adam5 UTSW 8 24786271 missense probably damaging 1.00
R4964:Adam5 UTSW 8 24786232 missense probably damaging 1.00
R5259:Adam5 UTSW 8 24810834 missense possibly damaging 0.90
R5293:Adam5 UTSW 8 24810706 missense possibly damaging 0.46
R5724:Adam5 UTSW 8 24804495 nonsense probably null
R5859:Adam5 UTSW 8 24813461 missense probably benign
R6004:Adam5 UTSW 8 24781669 missense probably benign 0.04
R6175:Adam5 UTSW 8 24786151 missense probably benign 0.00
R6539:Adam5 UTSW 8 24782600 missense possibly damaging 0.85
R6994:Adam5 UTSW 8 24786246 nonsense probably null
R6996:Adam5 UTSW 8 24806501 missense probably damaging 1.00
R7009:Adam5 UTSW 8 24806438 missense probably benign 0.00
R7115:Adam5 UTSW 8 24781696 missense possibly damaging 0.69
R7127:Adam5 UTSW 8 24810781 missense probably damaging 1.00
R7469:Adam5 UTSW 8 24815525 missense probably benign 0.45
R7780:Adam5 UTSW 8 24804416 missense possibly damaging 0.49
R8069:Adam5 UTSW 8 24813525 missense probably damaging 1.00
R8138:Adam5 UTSW 8 24781762 missense probably damaging 1.00
R8305:Adam5 UTSW 8 24810703 missense possibly damaging 0.93
R8359:Adam5 UTSW 8 24806486 missense probably damaging 1.00
R8480:Adam5 UTSW 8 24804459 nonsense probably null
R8743:Adam5 UTSW 8 24786248 missense probably damaging 1.00
X0019:Adam5 UTSW 8 24812443 missense probably benign 0.00
X0022:Adam5 UTSW 8 24813563 critical splice acceptor site probably null
X0027:Adam5 UTSW 8 24818772 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCACTGCACCTTTGAC -3'
(R):5'- AATCCCAACAAGGTTTTGACCC -3'

Sequencing Primer
(F):5'- CACCTTTGACATTGTAGGCACTGAAC -3'
(R):5'- CCAACAAGGTTTTGACCCTAAGTG -3'
Posted On2020-01-23