Incidental Mutation 'R8029:Nectin4'
ID 617796
Institutional Source Beutler Lab
Gene Symbol Nectin4
Ensembl Gene ENSMUSG00000006411
Gene Name nectin cell adhesion molecule 4
Synonyms Pvrl4, 1200017F15Rik, nectin 4, Prr4
MMRRC Submission 067468-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R8029 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 171197741-171215855 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 171214255 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 470 (D470G)
Ref Sequence ENSEMBL: ENSMUSP00000006578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006578] [ENSMUST00000056449] [ENSMUST00000094325] [ENSMUST00000111286]
AlphaFold Q8R007
Predicted Effect probably benign
Transcript: ENSMUST00000006578
AA Change: D470G

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000006578
Gene: ENSMUSG00000006411
AA Change: D470G

DomainStartEndE-ValueType
IG 36 145 9.26e-8 SMART
Pfam:Ig_2 147 241 4e-4 PFAM
Pfam:C2-set_2 150 233 9e-17 PFAM
IGc2 259 321 9.78e-7 SMART
transmembrane domain 348 370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056449
SMART Domains Protein: ENSMUSP00000059389
Gene: ENSMUSG00000048865

DomainStartEndE-ValueType
low complexity region 6 14 N/A INTRINSIC
RhoGAP 31 212 1.4e-61 SMART
Blast:RhoGAP 225 285 2e-24 BLAST
low complexity region 348 366 N/A INTRINSIC
low complexity region 367 378 N/A INTRINSIC
low complexity region 452 463 N/A INTRINSIC
low complexity region 498 510 N/A INTRINSIC
low complexity region 514 534 N/A INTRINSIC
low complexity region 667 690 N/A INTRINSIC
low complexity region 736 752 N/A INTRINSIC
low complexity region 924 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094325
AA Change: D445G

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000091883
Gene: ENSMUSG00000006411
AA Change: D445G

DomainStartEndE-ValueType
IG 36 145 9.26e-8 SMART
Pfam:Ig_2 147 241 2.1e-4 PFAM
Pfam:C2-set_2 150 233 8.7e-17 PFAM
IGc2 259 321 9.78e-7 SMART
transmembrane domain 348 370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111286
AA Change: D470G

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000106917
Gene: ENSMUSG00000006411
AA Change: D470G

DomainStartEndE-ValueType
IG 100 209 9.26e-8 SMART
Pfam:C2-set_2 214 297 1.2e-16 PFAM
IGc2 323 385 9.78e-7 SMART
transmembrane domain 412 434 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nectin family. The encoded protein contains two immunoglobulin-like (Ig-like) C2-type domains and one Ig-like V-type domain. It is involved in cell adhesion through trans-homophilic and -heterophilic interactions. It is a single-pass type I membrane protein. The soluble form is produced by proteolytic cleavage at the cell surface by the metalloproteinase ADAM17/TACE. The secreted form is found in both breast tumor cell lines and breast tumor patients. Mutations in this gene are the cause of ectodermal dysplasia-syndactyly syndrome type 1, an autosomal recessive disorder. Alternatively spliced transcript variants have been found but the full-length nature of the variant has not been determined.[provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c A G 2: 58,186,129 (GRCm39) I118T possibly damaging Het
Alpk1 T C 3: 127,522,934 (GRCm39) D36G possibly damaging Het
Aox1 G A 1: 58,382,827 (GRCm39) V1036I probably benign Het
Arhgef1 T C 7: 24,619,163 (GRCm39) L468P probably damaging Het
Armc2 A T 10: 41,802,996 (GRCm39) L559Q probably damaging Het
Asb3 A T 11: 31,051,180 (GRCm39) R506* probably null Het
Aspm A G 1: 139,399,370 (GRCm39) H1045R probably benign Het
Cacna1g G T 11: 94,300,564 (GRCm39) R2099S probably benign Het
Cd177 C T 7: 24,455,594 (GRCm39) W309* probably null Het
Cd34 A C 1: 194,640,860 (GRCm39) M242L probably benign Het
Cdh24 T A 14: 54,876,856 (GRCm39) N49I probably damaging Het
Ces2b A G 8: 105,561,482 (GRCm39) N192S probably damaging Het
Chsy3 A G 18: 59,312,519 (GRCm39) I331V possibly damaging Het
Disp1 A G 1: 182,870,852 (GRCm39) S523P probably damaging Het
Dlgap5 T C 14: 47,653,897 (GRCm39) H44R probably benign Het
Dnajc30 G T 5: 135,093,186 (GRCm39) A28S probably benign Het
Dsc2 C T 18: 20,165,331 (GRCm39) G881R possibly damaging Het
Exd1 A T 2: 119,359,204 (GRCm39) H226Q probably damaging Het
Gata6 T A 18: 11,054,944 (GRCm39) V291E possibly damaging Het
Get3 T C 8: 85,746,456 (GRCm39) M131V probably benign Het
Gfi1b A T 2: 28,503,687 (GRCm39) probably null Het
Grk3 T A 5: 113,109,508 (GRCm39) I150L probably benign Het
Gstcd C T 3: 132,787,868 (GRCm39) V277M probably damaging Het
Idua T C 5: 108,817,278 (GRCm39) F17S probably benign Het
Ighg1 T C 12: 113,292,765 (GRCm39) K268R Het
Lama1 G T 17: 68,124,589 (GRCm39) R2883M Het
Lpar3 T C 3: 145,946,718 (GRCm39) M132T probably benign Het
Macf1 T C 4: 123,338,685 (GRCm39) T4351A possibly damaging Het
Marchf6 A G 15: 31,496,148 (GRCm39) probably null Het
Mbtps1 C A 8: 120,274,544 (GRCm39) probably benign Het
Mctp1 T C 13: 77,178,005 (GRCm39) Y931H probably damaging Het
Mug2 A G 6: 122,058,504 (GRCm39) probably null Het
Myh1 G T 11: 67,102,066 (GRCm39) probably null Het
Mylk2 T C 2: 152,762,219 (GRCm39) S497P probably damaging Het
Nop2 C T 6: 125,121,383 (GRCm39) P722S possibly damaging Het
Nphp1 T C 2: 127,583,036 (GRCm39) T626A probably benign Het
Nudt9 C T 5: 104,198,477 (GRCm39) probably benign Het
Oplah T C 15: 76,189,896 (GRCm39) Y143C probably benign Het
Or10a3m T A 7: 108,313,037 (GRCm39) F159Y possibly damaging Het
Or12e10 A G 2: 87,640,376 (GRCm39) T71A probably benign Het
Or7e178 A G 9: 20,225,643 (GRCm39) F191S possibly damaging Het
Or7g20 T C 9: 18,947,090 (GRCm39) S224P probably damaging Het
Osbpl1a T G 18: 13,047,578 (GRCm39) E125D probably benign Het
P2ry1 C A 3: 60,910,943 (GRCm39) N27K possibly damaging Het
Palld A T 8: 62,330,346 (GRCm39) I177N probably damaging Het
Plcl1 A T 1: 55,735,237 (GRCm39) I193L probably benign Het
Polr1a T A 6: 71,889,940 (GRCm39) L53* probably null Het
Ppp1r9a A G 6: 5,057,518 (GRCm39) E531G possibly damaging Het
Prex1 C A 2: 166,417,523 (GRCm39) Q1361H probably benign Het
Ptprc T C 1: 138,006,197 (GRCm39) E795G probably damaging Het
Rars1 C T 11: 35,711,992 (GRCm39) V295I probably damaging Het
Rnaseh2b T C 14: 62,590,997 (GRCm39) V116A possibly damaging Het
Rnf43 T A 11: 87,622,720 (GRCm39) L480H probably benign Het
Rttn A G 18: 89,108,598 (GRCm39) T1601A not run Het
Setd1a C G 7: 127,385,386 (GRCm39) Q698E probably benign Het
Sh3gl3 T C 7: 81,920,091 (GRCm39) Y100H probably benign Het
Sis T C 3: 72,828,475 (GRCm39) Y1200C probably damaging Het
Snx13 A C 12: 35,169,885 (GRCm39) H610P probably damaging Het
Spata31d1e T C 13: 59,890,191 (GRCm39) H543R possibly damaging Het
Spdl1 T C 11: 34,713,419 (GRCm39) R217G probably benign Het
Spop G A 11: 95,365,193 (GRCm39) E113K probably benign Het
Sult2a3 G A 7: 13,855,553 (GRCm39) P101L probably damaging Het
Tbl1xr1 C T 3: 22,254,600 (GRCm39) H348Y probably damaging Het
Tmie T C 9: 110,696,555 (GRCm39) T109A possibly damaging Het
Ttc12 A G 9: 49,381,551 (GRCm39) V140A possibly damaging Het
Ube2m A G 7: 12,770,524 (GRCm39) L58P probably damaging Het
Urb1 A G 16: 90,576,040 (GRCm39) S839P possibly damaging Het
Vmn2r117 T A 17: 23,696,744 (GRCm39) D221V probably benign Het
Vps41 C T 13: 19,007,955 (GRCm39) Q263* probably null Het
Zfand3 A T 17: 30,354,407 (GRCm39) T75S probably benign Het
Zscan26 A G 13: 21,629,520 (GRCm39) C202R probably damaging Het
Other mutations in Nectin4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Nectin4 APN 1 171,212,254 (GRCm39) missense probably damaging 1.00
IGL01558:Nectin4 APN 1 171,212,257 (GRCm39) missense probably benign 0.00
IGL02608:Nectin4 APN 1 171,212,341 (GRCm39) missense probably benign 0.05
R2047:Nectin4 UTSW 1 171,212,720 (GRCm39) missense possibly damaging 0.61
R2203:Nectin4 UTSW 1 171,213,797 (GRCm39) missense possibly damaging 0.78
R2518:Nectin4 UTSW 1 171,207,776 (GRCm39) missense probably benign 0.00
R4125:Nectin4 UTSW 1 171,213,301 (GRCm39) missense probably benign 0.02
R4708:Nectin4 UTSW 1 171,212,714 (GRCm39) missense probably benign 0.02
R4856:Nectin4 UTSW 1 171,212,383 (GRCm39) missense possibly damaging 0.46
R4886:Nectin4 UTSW 1 171,212,383 (GRCm39) missense possibly damaging 0.46
R5222:Nectin4 UTSW 1 171,212,825 (GRCm39) splice site probably null
R5264:Nectin4 UTSW 1 171,211,273 (GRCm39) missense probably benign 0.00
R5661:Nectin4 UTSW 1 171,212,738 (GRCm39) missense probably damaging 1.00
R6466:Nectin4 UTSW 1 171,214,321 (GRCm39) missense probably damaging 1.00
R6714:Nectin4 UTSW 1 171,198,218 (GRCm39) start gained probably benign
R7272:Nectin4 UTSW 1 171,214,212 (GRCm39) missense probably damaging 1.00
R7302:Nectin4 UTSW 1 171,214,203 (GRCm39) nonsense probably null
R7318:Nectin4 UTSW 1 171,208,031 (GRCm39) missense probably benign 0.16
R7669:Nectin4 UTSW 1 171,207,827 (GRCm39) missense probably benign 0.00
R7732:Nectin4 UTSW 1 171,214,246 (GRCm39) missense probably benign 0.00
R7751:Nectin4 UTSW 1 171,211,326 (GRCm39) critical splice donor site probably null
R7912:Nectin4 UTSW 1 171,207,941 (GRCm39) missense possibly damaging 0.86
R7993:Nectin4 UTSW 1 171,211,322 (GRCm39) missense probably damaging 1.00
R8306:Nectin4 UTSW 1 171,211,325 (GRCm39) missense probably null 1.00
R8314:Nectin4 UTSW 1 171,212,295 (GRCm39) missense probably benign 0.44
R8475:Nectin4 UTSW 1 171,212,280 (GRCm39) nonsense probably null
R8807:Nectin4 UTSW 1 171,211,282 (GRCm39) missense probably damaging 1.00
R9054:Nectin4 UTSW 1 171,214,351 (GRCm39) missense probably damaging 1.00
R9383:Nectin4 UTSW 1 171,213,251 (GRCm39) missense probably damaging 1.00
R9526:Nectin4 UTSW 1 171,210,209 (GRCm39) nonsense probably null
R9580:Nectin4 UTSW 1 171,211,324 (GRCm39) missense probably damaging 1.00
R9667:Nectin4 UTSW 1 171,210,165 (GRCm39) missense probably damaging 1.00
R9782:Nectin4 UTSW 1 171,214,192 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAACTACCATTACCCTTGC -3'
(R):5'- AAGAAGAGCCGAAGTTCCCC -3'

Sequencing Primer
(F):5'- GGAACTACCATTACCCTTGCTTCAC -3'
(R):5'- TCCCCCATGGAAGCAGAAG -3'
Posted On 2020-01-23