Incidental Mutation 'R8029:Cd34'
ID617798
Institutional Source Beutler Lab
Gene Symbol Cd34
Ensembl Gene ENSMUSG00000016494
Gene NameCD34 antigen
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R8029 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location194938819-194961279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 194958552 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 242 (M242L)
Ref Sequence ENSEMBL: ENSMUSP00000016638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016638] [ENSMUST00000110815]
Predicted Effect probably benign
Transcript: ENSMUST00000016638
AA Change: M242L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000016638
Gene: ENSMUSG00000016494
AA Change: M242L

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 156 167 N/A INTRINSIC
Pfam:CD34_antigen 187 382 2.3e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110815
AA Change: M242L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106439
Gene: ENSMUSG00000016494
AA Change: M242L

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 156 167 N/A INTRINSIC
Pfam:CD34_antigen 187 325 3.5e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194036
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may play a role in the attachment of stem cells to the bone marrow extracellular matrix or to stromal cells. This single-pass membrane protein is highly glycosylated and phosphorylated by protein kinase C. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a null allele show decreased splenocyte number and hematopoietic defects. Homozygotes for another null allele show reduced eosinophil accumulation after allergen exposure, impaired TPA-induced hair follicle stem cell activation and reduced incidence of chemically-induced skin tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,377 H543R possibly damaging Het
Acvr1c A G 2: 58,296,117 I118T possibly damaging Het
Alpk1 T C 3: 127,729,285 D36G possibly damaging Het
Aox2 G A 1: 58,343,668 V1036I probably benign Het
Arhgef1 T C 7: 24,919,738 L468P probably damaging Het
Armc2 A T 10: 41,927,000 L559Q probably damaging Het
Asb3 A T 11: 31,101,180 R506* probably null Het
Asna1 T C 8: 85,019,827 M131V probably benign Het
Aspm A G 1: 139,471,632 H1045R probably benign Het
Cacna1g G T 11: 94,409,738 R2099S probably benign Het
Cd177 C T 7: 24,756,169 W309* probably null Het
Cdh24 T A 14: 54,639,399 N49I probably damaging Het
Ces2b A G 8: 104,834,850 N192S probably damaging Het
Chsy3 A G 18: 59,179,447 I331V possibly damaging Het
Disp1 A G 1: 183,089,288 S523P probably damaging Het
Dlgap5 T C 14: 47,416,440 H44R probably benign Het
Dnajc30 G T 5: 135,064,332 A28S probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Exd1 A T 2: 119,528,723 H226Q probably damaging Het
Gata6 T A 18: 11,054,944 V291E possibly damaging Het
Gfi1b A T 2: 28,613,675 probably null Het
Grk3 T A 5: 112,961,642 I150L probably benign Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Idua T C 5: 108,669,412 F17S probably benign Het
Ighg1 T C 12: 113,329,145 K268R Het
Lama1 G T 17: 67,817,594 R2883M Het
Lpar3 T C 3: 146,240,963 M132T probably benign Het
Macf1 T C 4: 123,444,892 T4351A possibly damaging Het
March6 A G 15: 31,496,002 probably null Het
Mbtps1 C A 8: 119,547,805 probably benign Het
Mctp1 T C 13: 77,029,886 Y931H probably damaging Het
Mug2 A G 6: 122,081,545 probably null Het
Myh1 G T 11: 67,211,240 probably null Het
Mylk2 T C 2: 152,920,299 S497P probably damaging Het
Nectin4 A G 1: 171,386,687 D470G probably benign Het
Nop2 C T 6: 125,144,420 P722S possibly damaging Het
Nphp1 T C 2: 127,741,116 T626A probably benign Het
Nudt9 C T 5: 104,050,611 probably benign Het
Olfr1145 A G 2: 87,810,032 T71A probably benign Het
Olfr18 A G 9: 20,314,347 F191S possibly damaging Het
Olfr512 T A 7: 108,713,830 F159Y possibly damaging Het
Olfr835 T C 9: 19,035,794 S224P probably damaging Het
Oplah T C 15: 76,305,696 Y143C probably benign Het
Osbpl1a T G 18: 12,914,521 E125D probably benign Het
P2ry1 C A 3: 61,003,522 N27K possibly damaging Het
Palld A T 8: 61,877,312 I177N probably damaging Het
Plcl1 A T 1: 55,696,078 I193L probably benign Het
Polr1a T A 6: 71,912,956 L53* probably null Het
Ppp1r9a A G 6: 5,057,518 E531G possibly damaging Het
Prex1 C A 2: 166,575,603 Q1361H probably benign Het
Ptprc T C 1: 138,078,459 E795G probably damaging Het
Rars C T 11: 35,821,165 V295I probably damaging Het
Rnaseh2b T C 14: 62,353,548 V116A possibly damaging Het
Rnf43 T A 11: 87,731,894 L480H probably benign Het
Rttn A G 18: 89,090,474 T1601A not run Het
Setd1a C G 7: 127,786,214 Q698E probably benign Het
Sh3gl3 T C 7: 82,270,883 Y100H probably benign Het
Sis T C 3: 72,921,142 Y1200C probably damaging Het
Snx13 A C 12: 35,119,886 H610P probably damaging Het
Spdl1 T C 11: 34,822,592 R217G probably benign Het
Spop G A 11: 95,474,367 E113K probably benign Het
Sult2a3 G A 7: 14,121,628 P101L probably damaging Het
Tbl1xr1 C T 3: 22,200,436 H348Y probably damaging Het
Tmie T C 9: 110,867,487 T109A possibly damaging Het
Ttc12 A G 9: 49,470,251 V140A possibly damaging Het
Ube2m A G 7: 13,036,597 L58P probably damaging Het
Urb1 A G 16: 90,779,152 S839P possibly damaging Het
Vmn2r117 T A 17: 23,477,770 D221V probably benign Het
Vps41 C T 13: 18,823,785 Q263* probably null Het
Zfand3 A T 17: 30,135,433 T75S probably benign Het
Zscan26 A G 13: 21,445,350 C202R probably damaging Het
Other mutations in Cd34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Cd34 APN 1 194960114 missense probably damaging 1.00
IGL00979:Cd34 APN 1 194949508 missense possibly damaging 0.92
IGL01762:Cd34 APN 1 194939033 missense probably benign 0.07
IGL01861:Cd34 APN 1 194958580 unclassified probably benign
IGL03227:Cd34 APN 1 194958463 missense probably damaging 1.00
R0628:Cd34 UTSW 1 194959217 missense probably damaging 1.00
R2057:Cd34 UTSW 1 194959142 missense probably damaging 1.00
R2249:Cd34 UTSW 1 194947952 missense possibly damaging 0.95
R2435:Cd34 UTSW 1 194939026 missense probably damaging 0.96
R4795:Cd34 UTSW 1 194951011 missense probably damaging 0.98
R5076:Cd34 UTSW 1 194948030 intron probably benign
R5400:Cd34 UTSW 1 194938958 unclassified probably benign
R5414:Cd34 UTSW 1 194947911 missense probably benign 0.05
R5641:Cd34 UTSW 1 194947968 missense probably benign 0.25
R6110:Cd34 UTSW 1 194949569 splice site probably null
R6148:Cd34 UTSW 1 194948008 critical splice donor site probably null
R6234:Cd34 UTSW 1 194948000 missense probably damaging 0.98
R7715:Cd34 UTSW 1 194949316 missense probably damaging 0.98
R8444:Cd34 UTSW 1 194958500 missense probably benign 0.00
R8490:Cd34 UTSW 1 194938973 missense probably benign 0.41
R8496:Cd34 UTSW 1 194959781 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGGTTACTAGTAATTTCACCTCTTGG -3'
(R):5'- AGAAGCCAGTCCAGCTCATC -3'

Sequencing Primer
(F):5'- GTAATTTCACCTCTTGGTTTCTTTTC -3'
(R):5'- ATCCTTCCATGTTGTCCTAGAAAC -3'
Posted On2020-01-23