Incidental Mutation 'R8029:Olfr1145'
ID617801
Institutional Source Beutler Lab
Gene Symbol Olfr1145
Ensembl Gene ENSMUSG00000068814
Gene Nameolfactory receptor 1145
SynonymsGA_x6K02T2Q125-49311440-49312384, MOR264-19
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R8029 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location87809822-87810799 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87810032 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 71 (T71A)
Ref Sequence ENSEMBL: ENSMUSP00000088209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079711] [ENSMUST00000090707]
Predicted Effect probably benign
Transcript: ENSMUST00000079711
AA Change: T60A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000078649
Gene: ENSMUSG00000068814
AA Change: T60A

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 3.4e-52 PFAM
Pfam:7tm_1 47 296 1.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090707
AA Change: T71A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000088209
Gene: ENSMUSG00000068814
AA Change: T71A

DomainStartEndE-ValueType
transmembrane domain 21 38 N/A INTRINSIC
Pfam:7tm_4 48 325 6.2e-58 PFAM
Pfam:7tm_1 58 307 1.5e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,377 H543R possibly damaging Het
Acvr1c A G 2: 58,296,117 I118T possibly damaging Het
Alpk1 T C 3: 127,729,285 D36G possibly damaging Het
Aox2 G A 1: 58,343,668 V1036I probably benign Het
Arhgef1 T C 7: 24,919,738 L468P probably damaging Het
Armc2 A T 10: 41,927,000 L559Q probably damaging Het
Asb3 A T 11: 31,101,180 R506* probably null Het
Asna1 T C 8: 85,019,827 M131V probably benign Het
Aspm A G 1: 139,471,632 H1045R probably benign Het
Cacna1g G T 11: 94,409,738 R2099S probably benign Het
Cd177 C T 7: 24,756,169 W309* probably null Het
Cd34 A C 1: 194,958,552 M242L probably benign Het
Cdh24 T A 14: 54,639,399 N49I probably damaging Het
Ces2b A G 8: 104,834,850 N192S probably damaging Het
Chsy3 A G 18: 59,179,447 I331V possibly damaging Het
Disp1 A G 1: 183,089,288 S523P probably damaging Het
Dlgap5 T C 14: 47,416,440 H44R probably benign Het
Dnajc30 G T 5: 135,064,332 A28S probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Exd1 A T 2: 119,528,723 H226Q probably damaging Het
Gata6 T A 18: 11,054,944 V291E possibly damaging Het
Gfi1b A T 2: 28,613,675 probably null Het
Grk3 T A 5: 112,961,642 I150L probably benign Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Idua T C 5: 108,669,412 F17S probably benign Het
Ighg1 T C 12: 113,329,145 K268R Het
Lama1 G T 17: 67,817,594 R2883M Het
Lpar3 T C 3: 146,240,963 M132T probably benign Het
Macf1 T C 4: 123,444,892 T4351A possibly damaging Het
March6 A G 15: 31,496,002 probably null Het
Mbtps1 C A 8: 119,547,805 probably benign Het
Mctp1 T C 13: 77,029,886 Y931H probably damaging Het
Mug2 A G 6: 122,081,545 probably null Het
Myh1 G T 11: 67,211,240 probably null Het
Mylk2 T C 2: 152,920,299 S497P probably damaging Het
Nectin4 A G 1: 171,386,687 D470G probably benign Het
Nop2 C T 6: 125,144,420 P722S possibly damaging Het
Nphp1 T C 2: 127,741,116 T626A probably benign Het
Nudt9 C T 5: 104,050,611 probably benign Het
Olfr18 A G 9: 20,314,347 F191S possibly damaging Het
Olfr512 T A 7: 108,713,830 F159Y possibly damaging Het
Olfr835 T C 9: 19,035,794 S224P probably damaging Het
Oplah T C 15: 76,305,696 Y143C probably benign Het
Osbpl1a T G 18: 12,914,521 E125D probably benign Het
P2ry1 C A 3: 61,003,522 N27K possibly damaging Het
Palld A T 8: 61,877,312 I177N probably damaging Het
Plcl1 A T 1: 55,696,078 I193L probably benign Het
Polr1a T A 6: 71,912,956 L53* probably null Het
Ppp1r9a A G 6: 5,057,518 E531G possibly damaging Het
Prex1 C A 2: 166,575,603 Q1361H probably benign Het
Ptprc T C 1: 138,078,459 E795G probably damaging Het
Rars C T 11: 35,821,165 V295I probably damaging Het
Rnaseh2b T C 14: 62,353,548 V116A possibly damaging Het
Rnf43 T A 11: 87,731,894 L480H probably benign Het
Rttn A G 18: 89,090,474 T1601A not run Het
Setd1a C G 7: 127,786,214 Q698E probably benign Het
Sh3gl3 T C 7: 82,270,883 Y100H probably benign Het
Sis T C 3: 72,921,142 Y1200C probably damaging Het
Snx13 A C 12: 35,119,886 H610P probably damaging Het
Spdl1 T C 11: 34,822,592 R217G probably benign Het
Spop G A 11: 95,474,367 E113K probably benign Het
Sult2a3 G A 7: 14,121,628 P101L probably damaging Het
Tbl1xr1 C T 3: 22,200,436 H348Y probably damaging Het
Tmie T C 9: 110,867,487 T109A possibly damaging Het
Ttc12 A G 9: 49,470,251 V140A possibly damaging Het
Ube2m A G 7: 13,036,597 L58P probably damaging Het
Urb1 A G 16: 90,779,152 S839P possibly damaging Het
Vmn2r117 T A 17: 23,477,770 D221V probably benign Het
Vps41 C T 13: 18,823,785 Q263* probably null Het
Zfand3 A T 17: 30,135,433 T75S probably benign Het
Zscan26 A G 13: 21,445,350 C202R probably damaging Het
Other mutations in Olfr1145
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Olfr1145 APN 2 87810648 missense probably damaging 1.00
IGL01335:Olfr1145 APN 2 87810446 missense probably damaging 1.00
PIT4418001:Olfr1145 UTSW 2 87810594 missense probably damaging 0.99
R1512:Olfr1145 UTSW 2 87810644 missense probably benign 0.23
R1700:Olfr1145 UTSW 2 87810768 missense probably benign
R2127:Olfr1145 UTSW 2 87810341 missense probably benign 0.09
R2162:Olfr1145 UTSW 2 87810360 missense probably damaging 1.00
R3707:Olfr1145 UTSW 2 87810176 missense probably damaging 1.00
R4327:Olfr1145 UTSW 2 87810152 missense probably benign 0.00
R4422:Olfr1145 UTSW 2 87810645 missense probably damaging 0.97
R4854:Olfr1145 UTSW 2 87810590 missense probably damaging 1.00
R5234:Olfr1145 UTSW 2 87810768 missense probably benign
R5858:Olfr1145 UTSW 2 87810641 missense probably benign 0.22
R6229:Olfr1145 UTSW 2 87810087 missense probably damaging 1.00
R6991:Olfr1145 UTSW 2 87810443 missense possibly damaging 0.76
R7007:Olfr1145 UTSW 2 87809886 missense probably damaging 1.00
R7027:Olfr1145 UTSW 2 87810716 missense possibly damaging 0.90
R7260:Olfr1145 UTSW 2 87810387 missense probably damaging 0.98
R7624:Olfr1145 UTSW 2 87810339 missense probably damaging 1.00
R7794:Olfr1145 UTSW 2 87810474 missense probably damaging 0.97
Z1088:Olfr1145 UTSW 2 87810746 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGACTCAGACTCCGACTAAATC -3'
(R):5'- GCGATCATAGGACATCACAGC -3'

Sequencing Primer
(F):5'- GACTCCGACTAAATCCTTTCTACAG -3'
(R):5'- GCCAGAAGGAAACATTCATCAGTTC -3'
Posted On2020-01-23