Mutagenetix > Incidental Mutation

Incidental Mutation 'R8029:Nphp1'

617803

Institutional Source

Beutler Lab

Gene Symbol

Nphp1

Ensembl Gene

ENSMUSG00000027378

Gene Name

nephronophthisis 1 (juvenile) homolog (human)

Synonyms

nephrocystin

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8029 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

127740732-127788897 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 127741116 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 626 (T626A)

Ref Sequence

ENSEMBL: ENSMUSP00000028857 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028857] [ENSMUST00000110357]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000028857
AA Change: T626A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000028857
Gene: ENSMUSG00000027378
AA Change: T626A

Domain	Start	End	E-Value	Type
low complexity region	118	143	N/A	INTRINSIC
SH3	158	214	5.91e-19	SMART
low complexity region	220	246	N/A	INTRINSIC
Blast:14_3_3	391	491	3e-55	BLAST
low complexity region	634	641	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110357
AA Change: T625A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000105986
Gene: ENSMUSG00000027378
AA Change: T625A

Domain	Start	End	E-Value	Type
low complexity region	118	143	N/A	INTRINSIC
SH3	158	214	5.91e-19	SMART
low complexity region	220	246	N/A	INTRINSIC
Blast:14_3_3	390	490	3e-55	BLAST
low complexity region	633	640	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with src homology domain 3 (SH3) patterns. This protein interacts with Crk-associated substrate, and it appears to function in the control of cell division, as well as in cell-cell and cell-matrix adhesion signaling, likely as part of a multifunctional complex localized in actin- and microtubule-based structures. Mutations in this gene cause familial juvenile nephronophthisis type 1, a kidney disorder involving both tubules and glomeruli. Defects in this gene are also associated with Senior-Loken syndrome type 1, also referred to as juvenile nephronophthisis with Leber amaurosis, which is characterized by kidney and eye disease, and with Joubert syndrome type 4, which is characterized by cerebellar ataxia, oculomotor apraxia, psychomotor delay and neonatal breathing abnormalities, sometimes including retinal dystrophy and renal disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male infertility due to defects in sperm maturation. Mice homozygous for another knock-out allele exhibit absent photoreceptor outer segment and photoreceptor degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,377	H543R	possibly damaging	Het
Acvr1c	A	G	2: 58,296,117	I118T	possibly damaging	Het
Alpk1	T	C	3: 127,729,285	D36G	possibly damaging	Het
Aox2	G	A	1: 58,343,668	V1036I	probably benign	Het
Arhgef1	T	C	7: 24,919,738	L468P	probably damaging	Het
Armc2	A	T	10: 41,927,000	L559Q	probably damaging	Het
Asb3	A	T	11: 31,101,180	R506*	probably null	Het
Asna1	T	C	8: 85,019,827	M131V	probably benign	Het
Aspm	A	G	1: 139,471,632	H1045R	probably benign	Het
Cacna1g	G	T	11: 94,409,738	R2099S	probably benign	Het
Cd177	C	T	7: 24,756,169	W309*	probably null	Het
Cd34	A	C	1: 194,958,552	M242L	probably benign	Het
Cdh24	T	A	14: 54,639,399	N49I	probably damaging	Het
Ces2b	A	G	8: 104,834,850	N192S	probably damaging	Het
Chsy3	A	G	18: 59,179,447	I331V	possibly damaging	Het
Disp1	A	G	1: 183,089,288	S523P	probably damaging	Het
Dlgap5	T	C	14: 47,416,440	H44R	probably benign	Het
Dnajc30	G	T	5: 135,064,332	A28S	probably benign	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Exd1	A	T	2: 119,528,723	H226Q	probably damaging	Het
Gata6	T	A	18: 11,054,944	V291E	possibly damaging	Het
Gfi1b	A	T	2: 28,613,675		probably null	Het
Grk3	T	A	5: 112,961,642	I150L	probably benign	Het
Gstcd	C	T	3: 133,082,107	V277M	probably damaging	Het
Idua	T	C	5: 108,669,412	F17S	probably benign	Het
Ighg1	T	C	12: 113,329,145	K268R		Het
Lama1	G	T	17: 67,817,594	R2883M		Het
Lpar3	T	C	3: 146,240,963	M132T	probably benign	Het
Macf1	T	C	4: 123,444,892	T4351A	possibly damaging	Het
March6	A	G	15: 31,496,002		probably null	Het
Mbtps1	C	A	8: 119,547,805		probably benign	Het
Mctp1	T	C	13: 77,029,886	Y931H	probably damaging	Het
Mug2	A	G	6: 122,081,545		probably null	Het
Myh1	G	T	11: 67,211,240		probably null	Het
Mylk2	T	C	2: 152,920,299	S497P	probably damaging	Het
Nectin4	A	G	1: 171,386,687	D470G	probably benign	Het
Nop2	C	T	6: 125,144,420	P722S	possibly damaging	Het
Nudt9	C	T	5: 104,050,611		probably benign	Het
Olfr1145	A	G	2: 87,810,032	T71A	probably benign	Het
Olfr18	A	G	9: 20,314,347	F191S	possibly damaging	Het
Olfr512	T	A	7: 108,713,830	F159Y	possibly damaging	Het
Olfr835	T	C	9: 19,035,794	S224P	probably damaging	Het
Oplah	T	C	15: 76,305,696	Y143C	probably benign	Het
Osbpl1a	T	G	18: 12,914,521	E125D	probably benign	Het
P2ry1	C	A	3: 61,003,522	N27K	possibly damaging	Het
Palld	A	T	8: 61,877,312	I177N	probably damaging	Het
Plcl1	A	T	1: 55,696,078	I193L	probably benign	Het
Polr1a	T	A	6: 71,912,956	L53*	probably null	Het
Ppp1r9a	A	G	6: 5,057,518	E531G	possibly damaging	Het
Prex1	C	A	2: 166,575,603	Q1361H	probably benign	Het
Ptprc	T	C	1: 138,078,459	E795G	probably damaging	Het
Rars	C	T	11: 35,821,165	V295I	probably damaging	Het
Rnaseh2b	T	C	14: 62,353,548	V116A	possibly damaging	Het
Rnf43	T	A	11: 87,731,894	L480H	probably benign	Het
Rttn	A	G	18: 89,090,474	T1601A	not run	Het
Setd1a	C	G	7: 127,786,214	Q698E	probably benign	Het
Sh3gl3	T	C	7: 82,270,883	Y100H	probably benign	Het
Sis	T	C	3: 72,921,142	Y1200C	probably damaging	Het
Snx13	A	C	12: 35,119,886	H610P	probably damaging	Het
Spdl1	T	C	11: 34,822,592	R217G	probably benign	Het
Spop	G	A	11: 95,474,367	E113K	probably benign	Het
Sult2a3	G	A	7: 14,121,628	P101L	probably damaging	Het
Tbl1xr1	C	T	3: 22,200,436	H348Y	probably damaging	Het
Tmie	T	C	9: 110,867,487	T109A	possibly damaging	Het
Ttc12	A	G	9: 49,470,251	V140A	possibly damaging	Het
Ube2m	A	G	7: 13,036,597	L58P	probably damaging	Het
Urb1	A	G	16: 90,779,152	S839P	possibly damaging	Het
Vmn2r117	T	A	17: 23,477,770	D221V	probably benign	Het
Vps41	C	T	13: 18,823,785	Q263*	probably null	Het
Zfand3	A	T	17: 30,135,433	T75S	probably benign	Het
Zscan26	A	G	13: 21,445,350	C202R	probably damaging	Het

Other mutations in Nphp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00570:Nphp1	APN	2	127763885	missense	probably damaging	0.99
IGL00589:Nphp1	APN	2	127763849	missense	probably damaging	1.00
IGL01143:Nphp1	APN	2	127780136	missense	probably benign	0.06
IGL01893:Nphp1	APN	2	127769644	missense	probably damaging	1.00
IGL01922:Nphp1	APN	2	127780069	missense	possibly damaging	0.95
IGL02123:Nphp1	APN	2	127754049	missense	probably benign	0.03
IGL02340:Nphp1	APN	2	127780067	nonsense	probably null
IGL02836:Nphp1	APN	2	127769623	missense	probably benign	0.00
IGL03109:Nphp1	APN	2	127768169	critical splice donor site	probably benign
R1632:Nphp1	UTSW	2	127770392	missense	probably benign	0.32
R1857:Nphp1	UTSW	2	127770376	missense	probably benign	0.00
R4425:Nphp1	UTSW	2	127788799	missense	possibly damaging	0.82
R4514:Nphp1	UTSW	2	127748087	missense	probably benign	0.26
R4546:Nphp1	UTSW	2	127766019	splice site	probably null
R4580:Nphp1	UTSW	2	127768169	critical splice donor site	probably null
R5634:Nphp1	UTSW	2	127759650	missense	possibly damaging	0.81
R7152:Nphp1	UTSW	2	127753979	missense	probably benign
R7326:Nphp1	UTSW	2	127761217	missense	possibly damaging	0.76
R7985:Nphp1	UTSW	2	127745909	missense	probably damaging	0.97
R8715:Nphp1	UTSW	2	127763809	missense	possibly damaging	0.91
R8967:Nphp1	UTSW	2	127740977	missense	probably damaging	1.00
R8997:Nphp1	UTSW	2	127754062	missense	possibly damaging	0.88
R9328:Nphp1	UTSW	2	127740972	missense	possibly damaging	0.77
R9450:Nphp1	UTSW	2	127774088	missense
R9755:Nphp1	UTSW	2	127754031	nonsense	probably null
X0022:Nphp1	UTSW	2	127761214	missense	probably damaging	1.00
X0025:Nphp1	UTSW	2	127779127	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- CCAAGAAGTCAAAGGTCTGCTC -3'
(R):5'- GCTCTGGGCTCTTACAACAC -3'

Sequencing Primer
(F):5'- TCAAAGGTCTGCTCCGAAAG -3'
(R):5'- TGGGCTCTTACAACACTGAGC -3'

Posted On

2020-01-23