Incidental Mutation 'R8029:Nphp1'
ID 617803
Institutional Source Beutler Lab
Gene Symbol Nphp1
Ensembl Gene ENSMUSG00000027378
Gene Name nephronophthisis 1 (juvenile) homolog (human)
Synonyms nephrocystin
MMRRC Submission 067468-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8029 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 127582652-127630817 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 127583036 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 626 (T626A)
Ref Sequence ENSEMBL: ENSMUSP00000028857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028857] [ENSMUST00000110357]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000028857
AA Change: T626A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000028857
Gene: ENSMUSG00000027378
AA Change: T626A

DomainStartEndE-ValueType
low complexity region 118 143 N/A INTRINSIC
SH3 158 214 5.91e-19 SMART
low complexity region 220 246 N/A INTRINSIC
Blast:14_3_3 391 491 3e-55 BLAST
low complexity region 634 641 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110357
AA Change: T625A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105986
Gene: ENSMUSG00000027378
AA Change: T625A

DomainStartEndE-ValueType
low complexity region 118 143 N/A INTRINSIC
SH3 158 214 5.91e-19 SMART
low complexity region 220 246 N/A INTRINSIC
Blast:14_3_3 390 490 3e-55 BLAST
low complexity region 633 640 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with src homology domain 3 (SH3) patterns. This protein interacts with Crk-associated substrate, and it appears to function in the control of cell division, as well as in cell-cell and cell-matrix adhesion signaling, likely as part of a multifunctional complex localized in actin- and microtubule-based structures. Mutations in this gene cause familial juvenile nephronophthisis type 1, a kidney disorder involving both tubules and glomeruli. Defects in this gene are also associated with Senior-Loken syndrome type 1, also referred to as juvenile nephronophthisis with Leber amaurosis, which is characterized by kidney and eye disease, and with Joubert syndrome type 4, which is characterized by cerebellar ataxia, oculomotor apraxia, psychomotor delay and neonatal breathing abnormalities, sometimes including retinal dystrophy and renal disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male infertility due to defects in sperm maturation. Mice homozygous for another knock-out allele exhibit absent photoreceptor outer segment and photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c A G 2: 58,186,129 (GRCm39) I118T possibly damaging Het
Alpk1 T C 3: 127,522,934 (GRCm39) D36G possibly damaging Het
Aox1 G A 1: 58,382,827 (GRCm39) V1036I probably benign Het
Arhgef1 T C 7: 24,619,163 (GRCm39) L468P probably damaging Het
Armc2 A T 10: 41,802,996 (GRCm39) L559Q probably damaging Het
Asb3 A T 11: 31,051,180 (GRCm39) R506* probably null Het
Aspm A G 1: 139,399,370 (GRCm39) H1045R probably benign Het
Cacna1g G T 11: 94,300,564 (GRCm39) R2099S probably benign Het
Cd177 C T 7: 24,455,594 (GRCm39) W309* probably null Het
Cd34 A C 1: 194,640,860 (GRCm39) M242L probably benign Het
Cdh24 T A 14: 54,876,856 (GRCm39) N49I probably damaging Het
Ces2b A G 8: 105,561,482 (GRCm39) N192S probably damaging Het
Chsy3 A G 18: 59,312,519 (GRCm39) I331V possibly damaging Het
Disp1 A G 1: 182,870,852 (GRCm39) S523P probably damaging Het
Dlgap5 T C 14: 47,653,897 (GRCm39) H44R probably benign Het
Dnajc30 G T 5: 135,093,186 (GRCm39) A28S probably benign Het
Dsc2 C T 18: 20,165,331 (GRCm39) G881R possibly damaging Het
Exd1 A T 2: 119,359,204 (GRCm39) H226Q probably damaging Het
Gata6 T A 18: 11,054,944 (GRCm39) V291E possibly damaging Het
Get3 T C 8: 85,746,456 (GRCm39) M131V probably benign Het
Gfi1b A T 2: 28,503,687 (GRCm39) probably null Het
Grk3 T A 5: 113,109,508 (GRCm39) I150L probably benign Het
Gstcd C T 3: 132,787,868 (GRCm39) V277M probably damaging Het
Idua T C 5: 108,817,278 (GRCm39) F17S probably benign Het
Ighg1 T C 12: 113,292,765 (GRCm39) K268R Het
Lama1 G T 17: 68,124,589 (GRCm39) R2883M Het
Lpar3 T C 3: 145,946,718 (GRCm39) M132T probably benign Het
Macf1 T C 4: 123,338,685 (GRCm39) T4351A possibly damaging Het
Marchf6 A G 15: 31,496,148 (GRCm39) probably null Het
Mbtps1 C A 8: 120,274,544 (GRCm39) probably benign Het
Mctp1 T C 13: 77,178,005 (GRCm39) Y931H probably damaging Het
Mug2 A G 6: 122,058,504 (GRCm39) probably null Het
Myh1 G T 11: 67,102,066 (GRCm39) probably null Het
Mylk2 T C 2: 152,762,219 (GRCm39) S497P probably damaging Het
Nectin4 A G 1: 171,214,255 (GRCm39) D470G probably benign Het
Nop2 C T 6: 125,121,383 (GRCm39) P722S possibly damaging Het
Nudt9 C T 5: 104,198,477 (GRCm39) probably benign Het
Oplah T C 15: 76,189,896 (GRCm39) Y143C probably benign Het
Or10a3m T A 7: 108,313,037 (GRCm39) F159Y possibly damaging Het
Or12e10 A G 2: 87,640,376 (GRCm39) T71A probably benign Het
Or7e178 A G 9: 20,225,643 (GRCm39) F191S possibly damaging Het
Or7g20 T C 9: 18,947,090 (GRCm39) S224P probably damaging Het
Osbpl1a T G 18: 13,047,578 (GRCm39) E125D probably benign Het
P2ry1 C A 3: 60,910,943 (GRCm39) N27K possibly damaging Het
Palld A T 8: 62,330,346 (GRCm39) I177N probably damaging Het
Plcl1 A T 1: 55,735,237 (GRCm39) I193L probably benign Het
Polr1a T A 6: 71,889,940 (GRCm39) L53* probably null Het
Ppp1r9a A G 6: 5,057,518 (GRCm39) E531G possibly damaging Het
Prex1 C A 2: 166,417,523 (GRCm39) Q1361H probably benign Het
Ptprc T C 1: 138,006,197 (GRCm39) E795G probably damaging Het
Rars1 C T 11: 35,711,992 (GRCm39) V295I probably damaging Het
Rnaseh2b T C 14: 62,590,997 (GRCm39) V116A possibly damaging Het
Rnf43 T A 11: 87,622,720 (GRCm39) L480H probably benign Het
Rttn A G 18: 89,108,598 (GRCm39) T1601A not run Het
Setd1a C G 7: 127,385,386 (GRCm39) Q698E probably benign Het
Sh3gl3 T C 7: 81,920,091 (GRCm39) Y100H probably benign Het
Sis T C 3: 72,828,475 (GRCm39) Y1200C probably damaging Het
Snx13 A C 12: 35,169,885 (GRCm39) H610P probably damaging Het
Spata31d1e T C 13: 59,890,191 (GRCm39) H543R possibly damaging Het
Spdl1 T C 11: 34,713,419 (GRCm39) R217G probably benign Het
Spop G A 11: 95,365,193 (GRCm39) E113K probably benign Het
Sult2a3 G A 7: 13,855,553 (GRCm39) P101L probably damaging Het
Tbl1xr1 C T 3: 22,254,600 (GRCm39) H348Y probably damaging Het
Tmie T C 9: 110,696,555 (GRCm39) T109A possibly damaging Het
Ttc12 A G 9: 49,381,551 (GRCm39) V140A possibly damaging Het
Ube2m A G 7: 12,770,524 (GRCm39) L58P probably damaging Het
Urb1 A G 16: 90,576,040 (GRCm39) S839P possibly damaging Het
Vmn2r117 T A 17: 23,696,744 (GRCm39) D221V probably benign Het
Vps41 C T 13: 19,007,955 (GRCm39) Q263* probably null Het
Zfand3 A T 17: 30,354,407 (GRCm39) T75S probably benign Het
Zscan26 A G 13: 21,629,520 (GRCm39) C202R probably damaging Het
Other mutations in Nphp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Nphp1 APN 2 127,605,805 (GRCm39) missense probably damaging 0.99
IGL00589:Nphp1 APN 2 127,605,769 (GRCm39) missense probably damaging 1.00
IGL01143:Nphp1 APN 2 127,622,056 (GRCm39) missense probably benign 0.06
IGL01893:Nphp1 APN 2 127,611,564 (GRCm39) missense probably damaging 1.00
IGL01922:Nphp1 APN 2 127,621,989 (GRCm39) missense possibly damaging 0.95
IGL02123:Nphp1 APN 2 127,595,969 (GRCm39) missense probably benign 0.03
IGL02340:Nphp1 APN 2 127,621,987 (GRCm39) nonsense probably null
IGL02836:Nphp1 APN 2 127,611,543 (GRCm39) missense probably benign 0.00
IGL03109:Nphp1 APN 2 127,610,089 (GRCm39) critical splice donor site probably benign
R1632:Nphp1 UTSW 2 127,612,312 (GRCm39) missense probably benign 0.32
R1857:Nphp1 UTSW 2 127,612,296 (GRCm39) missense probably benign 0.00
R4425:Nphp1 UTSW 2 127,630,719 (GRCm39) missense possibly damaging 0.82
R4514:Nphp1 UTSW 2 127,590,007 (GRCm39) missense probably benign 0.26
R4546:Nphp1 UTSW 2 127,607,939 (GRCm39) splice site probably null
R4580:Nphp1 UTSW 2 127,610,089 (GRCm39) critical splice donor site probably null
R5634:Nphp1 UTSW 2 127,601,570 (GRCm39) missense possibly damaging 0.81
R7152:Nphp1 UTSW 2 127,595,899 (GRCm39) missense probably benign
R7326:Nphp1 UTSW 2 127,603,137 (GRCm39) missense possibly damaging 0.76
R7985:Nphp1 UTSW 2 127,587,829 (GRCm39) missense probably damaging 0.97
R8715:Nphp1 UTSW 2 127,605,729 (GRCm39) missense possibly damaging 0.91
R8967:Nphp1 UTSW 2 127,582,897 (GRCm39) missense probably damaging 1.00
R8997:Nphp1 UTSW 2 127,595,982 (GRCm39) missense possibly damaging 0.88
R9328:Nphp1 UTSW 2 127,582,892 (GRCm39) missense possibly damaging 0.77
R9450:Nphp1 UTSW 2 127,616,008 (GRCm39) missense
R9755:Nphp1 UTSW 2 127,595,951 (GRCm39) nonsense probably null
X0022:Nphp1 UTSW 2 127,603,134 (GRCm39) missense probably damaging 1.00
X0025:Nphp1 UTSW 2 127,621,047 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CCAAGAAGTCAAAGGTCTGCTC -3'
(R):5'- GCTCTGGGCTCTTACAACAC -3'

Sequencing Primer
(F):5'- TCAAAGGTCTGCTCCGAAAG -3'
(R):5'- TGGGCTCTTACAACACTGAGC -3'
Posted On 2020-01-23